ORFeome > pno1 – XORFeome 2.0

pno1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis partner of NOB1 homolog, mRNA (cDNA clone MGC:89796 IMAGE:7028131), complete cds
Gene Symbol: pno1
Gene ID: 448715
ORF gb_acc: MG133166
ORF ID: 10614

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC077670

Library Location

Plate ID: GDExt11006
Well Location: A03

EST Sequences

Clone: MGC:89796 IMAGE:7028131
Trimmed Sequence: ATGGAGACCGAAAGCGCCGCAGCCTCCGGGGAAAGTTTCACAAGTGTCACCTCTAAAAAAACCAGGAAGAGAAGAGCGGCCGAGGAGAGGCCCATGGACACCGGGGAGCAGCCGAGTAAGAGGCCGGACTTTCCTCCCATCTCTGGGGATAAGCTGATGGGAGACAAAGATGAAATGAGGAAAGTCCCCGTCCCCTCACACAGGTACACTCCTCTTAAAGAAAACTGGATGAAAATCTTCACTCCGATTGTGGAACACTTACAGCTTCAAGTGCGGTTCAACCTAAAGACAAGAAATGTAGAAATAAAGACTTGCAAGGAAACCACAGATGTTGGCGCATTAACAAAAGCAACTGATTTTGTCAGAGCCTTTATTCTGGGGTTTCAGGTTGAGGATGCGTTAGCCCTGGTCCGGCTCGACGATCTCTTCTTGGAATCATTTGAAGTCACAGATGTTAAACCGCTGAAGGGAGACCACTTGTCTCGGGCCATTGGGCGGATAGCTGGAAAAGGAGGCAAGACAAAGTTCACCATAGAAAATGTCACAAGGACAAGAATAGTTCTTGCTGATTCAAAAATACACATACTGGGATCCTTTCAGAACATCAAGATGGCCAGGACTGCAATCTGTAACCTTATCTTAGGAAGTCCTCCATCCAAAGTGTACGGCAACATACGGGCAGTGGCAAGTCGCGCTGCCGATAGGTTCTAA
Full Trace Sequence: gtctctgggacccggatggctgctgagatgcacgtgtagtgatatcgctgggaactatcggaatagagtttttttctatcgcttctgtttggaataaatcacatcgcaagaatggagaccgaaagcgccgcagcctccggggaaagtttcacaagtgtcacctctaaaaaaaccaggaagagaagagcggccgaggagaggcccatggacaccggggagcagccgagtaagaggccggactttcctcccatctctggggataagctgatgggagacaaagatgaaatgaggaaagtccccgtcccctcacacaggtacactcctcttaaagaaaactggatgaaaatcttcactccgattgtggaacacttacagcttcaagtgcggttcaacctaaagacaagaaatgtagaaataaagacttgcaaggaaaccacagatgttggcgcattaacaaaagcaactgattttgtcagagcctttattctggggtttcaggttgaggatgcgttagccctggtccggctcgacgatctcttcttggaatcatttgaagtcacagatgttaaaccgctgaagggagaccacttgtctcgggccattgggcggatagctggaaaaggaggcaagacaaagttcaccatagaaaatgtcacaaggacaagaatagttcttgctgattcaaaaatacacatactgggatcctttcagaacatcaagatggccaggactgcaatctgtaaccttatcttaggaagtcctccatccaaagtgtacggcaacatacgggcagtggcaagtcgcgctgccgataggttctaacattgcgtgaagtggaacgactgaacatcctatcaatgtggccccacttacatctacctatgtgcaatgaaacggcgtgcagaagagaagatctcattggcagaatctctggcaacatttacatcaaagaaccagctggttggctcagacttgtctggctcttcccattaatatttaagtggtgttaaagacttgaacctataaaggattacacctctgccaatacactgtgaaaataaatcaataaatacaaaaaaaaaaaaaaaaaaa
Translation: METESAAASGESFTSVTSKKTRKRRAAEERPMDTGEQPSKRPDFPPISGDKLMGDKDEMRKVPVPSHRYTPLKENWMKIFTPIVEHLQLQVRFNLKTRNVEIKTCKETTDVGALTKATDFVRAFILGFQVEDALALVRLDDLFLESFEVTDVKPLKGDHLSRAIGRIAGKGGKTKFTIENVTRTRIVLADSKIHILGSFQNIKMARTAICNLILGSPPSKVYGNIRAVASRAADRF
Donor tissue: