ORFeome > prmt1 – XORFeome 2.0

prmt1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis protein arginine methyltransferase 1, mRNA (cDNA clone MGC:69475 IMAGE:5336129), complete cds
Gene Symbol: prmt1
Gene ID: 448086
ORF gb_acc: MG133402
ORF ID: 10910

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074614

Library Location

Plate ID: GDExt11008
Well Location: F06

EST Sequences

Clone: MGC:69475 IMAGE:5336129
Trimmed Sequence: ATGGAGGTTTCTTGTACTCAGCCTGAGAGCAGTGTGAAGCCAAATGCGGAGGACATGACATCAAAAGATTACTACTTTGACTCGTATGCTCACTTTGGCATCCATGAGGAGATGTTAAAAGATGAAGTTCGAACGCTGACATATCGTAACTCAATGTTTCACAACAGACATCTATTTAAAGATAAAGTAGTCTTGGATGTTGGGAGTGGCACGGGTATTCTCTGCATGTTTGCAGCAAAGGCTGGTGCCAAGAAAGTTATTGGGATTGAGTGCTCAAGTATATCTGACTATGCCATAAAAATCGTGAAGGCAAATAAACTAGATCATGTGGTTACAATCATCAAAGGCAAAGTAGAAGAGGTGGAGCTCCCAGTAGAAAAAGTGGACATCATAATCAGTGAATGGATGGGATATTGTCTGTTCTATGAATCAATGCTGAACACTGTTATCTATGCACGGGATAAATGGCTGACTCCAGATGGGTTAATATTTCCAGATCGTGCTACACTGTATGTAACTGCTATTGAGGATAGACAATACAAAGACTACAAAATTCACTGGTGGGAAAACGTTTATGGCTTTGATATGTCATGCATCAAGGATGTAGCCATCAAGGAGCCTCTGGTTGATGTTGTTGATCCCAAACAACTGGTCACTAATGCTTGCCTTATAAAGGAAGTTGATATTTATACTGTCAAAGTTGACGACCTGACCTTTACCTCTCCATTCTGCCTGCAAGTGAAACGGAATGATTACATCCATGCACTAGTTGCTTATTTCAACATTGAATTTACACGGTGCCACAAAAGAACTGGCTTCTCTACAAGTCCTGAGTCTCCGTACACTCACTGGAAGCAAACAGTCTTCTACATGGAAGATTATCTCACTGTTAAGACTGGCGAGGAGATTTTTGGTACCATAAGCATGAAGCCAAATGCCAAAAACAATCGTGACTTGGATTTTACCGTTGACATTGACTTCAAGGGGCAGCTTTGTGAGCTGTCATGTTCGACAGACTACAGAATGCGTTGA
Full Trace Sequence: ccggtggcgtggctttgagtttcttttttagattcgtgagagagactgacaaacatggctgaagcgagcacctgcaacatggaggtttcttgtactcagcctgagagcagtgtgaagccaaatgcggaggacatgacatcaaaagattactactttgactcgtatgctcactttggcatccatgaggagatgttaaaagatgaagttcgaacgctgacatatcgtaactcaatgtttcacaacagacatctatttaaagataaagtagtcttggatgttgggagtggcacgggtattctctgcatgtttgcagcaaaggctggtgccaagaaagttattgggattgagtgctcaagtatatctgactatgccataaaaatcgtgaaggcaaataaactagatcatgtggttacaatcatcaaaggcaaagtagaagaggtggagctcccagtagaaaaagtggacatcataatcagtgaatggatgggatattgtctgttctatgaatcaatgctgaacactgttatctatgcacgggataaatggctgactccagatgggttaatatttccagatcgtgctacactgtatgtaactgctattgaggatagacaatacaaagactacaaaattcactggtgggaaaacgtttatggctttgatatgtcatgcatcaaggatgtagccatcaaggagcctctggttgatgttgttgatcccaaacaactggtcactaatgcttgccttataaaggaagttgatatttatactgtcaaagttgacgacctgacctttacctctccattctgcctgcaagtgaaacggaatgattacatccatgcactagttgcttatttcaacattgaatttacacggtgccacaaaagaactggcttctctacaagtcctgagtctccgtacactcactggaagcaaacagtcttctacatggaagattatctcactgttaagactggcgaggagatttttggtaccataagcatgaagccaaatgccaaaaacaatcgtgacttggattttaccgttgacattgacttcaaggggcagctttgtgagctgtcatgttcgacagactacagaatgcgttgagactacaaaccagccgacctgcctgaagaaactgaaaaccaatgcatcatgtataacatttagctgtgtggttttatttacatagtctacaaagttttaacccctgctgctagccacaaatggggaacattttagaagcccagttcagtgtagagtgcaagagctccttggtgaaaccaaaagcactgatcttgtcctccactgtggccattaaggctagagtattgatccagctccttggctgggttcatcatgtaaataaagatccataatggattcaaaccatctgttcagtttccgagccccctaagttttcctgcctttagcaggtctatcccaagaggcattcctttttgtttttagtatattcagtcaatgaattgctagaattgcagactattttaacaataggaaacccattacttgattactgagtggcctaaaggggtatacactgcaaaagtattcagcccctgctggcagcaaagtgttaagctccaaagtgtgcattccctttcactttttttttgcaggacttttttttttttttttaactaatggacactatcagggtgggttttctgtcctgttgcaatgtgtatggtatcaccagtatcccttgtctagcccttatgaggagcaggcacccatcctattgaggaacaaaagggttgctcacttggcttgggtgttttgtactgtttttgtaagtcctctcagaccttggtatggaaaggcccttcatttgttttattgatccttcaagcttcccattgtgactgtttcataacttatggtttttatatggttgcattcataatgaaattaaaaagtgaactgtgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEVSCTQPESSVKPNAEDMTSKDYYFDSYAHFGIHEEMLKDEVRTLTYRNSMFHNRHLFKDKVVLDVGSGTGILCMFAAKAGAKKVIGIECSSISDYAIKIVKANKLDHVVTIIKGKVEEVELPVEKVDIIISEWMGYCLFYESMLNTVIYARDKWLTPDGLIFPDRATLYVTAIEDRQYKDYKIHWWENVYGFDMSCIKDVAIKEPLVDVVDPKQLVTNACLIKEVDIYTVKVDDLTFTSPFCLQVKRNDYIHALVAYFNIEFTRCHKRTGFSTSPESPYTHWKQTVFYMEDYLTVKTGEEIFGTISMKPNAKNNRDLDFTVDIDFKGQLCELSCSTDYRMR
Donor tissue: tailbud