ORFeome > prpsap1 – XORFeome 2.0

prpsap1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis phosphoribosyl pyrophosphate synthetase-associated protein 1, mRNA (cDNA clone MGC:75778 IMAGE:5381900), complete cds
Gene Symbol: prpsap1
Gene ID: 394550
ORF gb_acc: MG132945
ORF ID: 10319

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061306

Library Location

Plate ID: GDExt11004
Well Location: H03

EST Sequences

Clone: MGC:75778 IMAGE:5381900
Trimmed Sequence: ATGAACTCAGCCAGATGTGGATACCGAGTCTTCTCTGCCAACTCCAGCGAGGCCTGCATGGAACTGGCCAAGAAAATCACAGAGCGCTTGGGAGCAGAGTTGGGGAAAGCGGTTGTATACCAGGAAAGTAATGGAGAAACACGAGTAGAGATCAAGGAATCAGTCAGAGGGCACAATATCTTCATTATACAGACAATTCCAAGAGATGTCAACACGGCCATCATGGAGCTGCTGATCATGGCCTACGCCCTGAAGACTTCCTGCGCCAACAGCATCATTGGCGTCATCCCGTATTTCCCGTACAGCAAGCAGAGCAAGATGCGCAAGCGGGGCTCCATTGTGTGCAAGCTGCTGGCTTCCATGATGTCTGACGCAGGGCTCACACATATAATTACTATGGATCTGCACCAGAAGGAGATACAGGGATTCTTTAATTTCCCCGTGGACAACCTGCGAGCCTCCCCGTTCCTGCTGCAGTACATCCAGGACGAGATCCAAAACTACAAAAATGCCGTCATAGTTGCCAAGTCACCGGATGCAGCCAAAAGGGCACAGTCTTACGCAGAGCGCCTCCGCTTGGGCCTTGCTGTCATACACGGGGAGCCGCAGTGTGCGGAGCTTGATATGGTCGATGGGCGCCACTCTCCCCCCACTGTGAAGAACACGGTGCACAAAGGACTGGAGATCCCCTTGATGATGCCCAAGGAGAAGCCACCCATCAGCTTGGTTGGAGATGTGCACGGAAAGATCGCCATCATTGTGGATGATATTATCGATGAGGTGGAGAGCTTTGTGGCAGCGGCAGATATTCTGAAAGAACGCGGGGCCTTCAAGGTCTATGCCATGGCGACCCACGGGATCCTGTCGTCTGATGCCCCGCGCCTCCTAGAACTTTCCGCTATAGATGAGGTGGTAGTGACCAACACCATCCCACACGAGCTCCAGAAGCAGCAGTGTTCCAAAATCAGAACAGTGGACATAAGCCTGATCCTCTCCGAGGCCATCCGGCGGATCCATAACGGAGAGTCCATGTCCTACCTCTTCCGAAACATTGCACTGGATGACTGA
Full Trace Sequence: ctgagacacagggacaccgaactgctgcttcttcatcatgccacgacggatgctaatgcctcacaagtctgttttctcttactcccgccccccaaagtggctgaatggtggtcacaccatgaactcagccagatgtggataccgagtcttctctgccaactccagcgaggcctgcatggaactggccaagaaaatcacagagcgcttgggagcagagttggggaaagcggttgtataccaggaaagtaatggagaaacacgagtagagatcaaggaatcagtcagagggcacaatatcttcattatacagacaattccaagagatgtcaacacggccatcatggagctgctgatcatggcctacgccctgaagacttcctgcgccaacagcatcattggcgtcatcccgtatttcccgtacagcaagcagagcaagatgcgcaagcggggctccattgtgtgcaagctgctggcttccatgatgtctgacgcagggctcacacatataattactatggatctgcaccagaaggagatacagggattctttaatttccccgtggacaacctgcgagcctccccgttcctgctgcagtacatccaggacgagatccaaaactacaaaaatgccgtcatagttgccaagtcaccggatgcagccaaaagggcacagtcttacgcagagcgcctccgcttgggccttgctgtcatacacggggagccgcagtgtgcggagcttgatatggtcgatgggcgccactctccccccactgtgaagaacacggtgcacaaaggactggagatccccttgatgatgcccaaggagaagccacccatcagcttggttggagatgtgcacggaaagatcgccatcattgtggatgatattatcgatgaggtggagagctttgtggcagcggcagatattctgaaagaacgcggggccttcaaggtctatgccatggcgacccacgggatcctgtcgtctgatgccccgcgcctcctagaactttccgctatagatgaggtggtagtgaccaacaccatcccacacgagctccagaagcagcagtgttccaaaatcagaacagtggacataagcctgatcctctccgaggccatccggcggatccataacggagagtccatgtcctacctcttccgaaacattgcactggatgactgagcgtgccgctctggtcggagcgccacgcgggcacgtgaactagttgggccggagttaagcggtgcgccagtcgccgtgcaccacgttgtttgaagtttttacactatggcaatatgccactttctggaaggagaatggaagcgtcggcgcatgatttggcaatccctctgcagggcggaaagtgaattacaattggccgtggccgggtcggatctctaccagtcggaagcatgagctgcaatgattccctttgtattagctggatggtgtgtggatggggccgacccgcgccggagctgccgtggttaggctcgtggcagccaatgctgttctcagtgtcacagaataggaggcgcacagaacacatgtgcagttacacgcatgtgccggcatgcttattatccgtacataccgctaaacacacaatcatggagaaacaggtacattgaacacgtgttgtgcccacacgggatttgtctgtacatgaagcagacacacccatgaggccggtttagtatgtagggacgtacgtattcatgtctgccctttgtatgcacgtacatagaaaccgtatgtatattgcatacatgctgtacacacgctgctgcaaagtgggctactttttacagcattaatgtaaagcgagtcactaagcccttcttttttgagttgtcccagtcgcatccttttgctttaaagctgccccatgtggccaatctggccaacgttctgcacaaatgacactgtgacggcagccatctttaatgctggaaaccttggcaataacttatagaaacttggctccttgcggcttctctaaactaaaacccttaatcacagtttcttttccctctgtgtttcccctgcggggggcgagacgctctctccctgccggaggtacgcccggttcctccctccgcacacgtcgcttccagacagcactgtgattatgttgtttaccccaatggcaggcgattgaagatcccgagaggatgtctgatttatgcaaacgttccttttctattggttttattacaataaggatgctttgttttcctgttcttgttctcagatgttgtattcagagttgtttatttttaattacaagttgaagaaacaaaaaaaatcgaacgtgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNSARCGYRVFSANSSEACMELAKKITERLGAELGKAVVYQESNGETRVEIKESVRGHNIFIIQTIPRDVNTAIMELLIMAYALKTSCANSIIGVIPYFPYSKQSKMRKRGSIVCKLLASMMSDAGLTHIITMDLHQKEIQGFFNFPVDNLRASPFLLQYIQDEIQNYKNAVIVAKSPDAAKRAQSYAERLRLGLAVIHGEPQCAELDMVDGRHSPPTVKNTVHKGLEIPLMMPKEKPPISLVGDVHGKIAIIVDDIIDEVESFVAAADILKERGAFKVYAMATHGILSSDAPRLLELSAIDEVVVTNTIPHELQKQQCSKIRTVDISLILSEAIRRIHNGESMSYLFRNIALDD
Donor tissue: tadpole