ORFeome > psma7 – XORFeome 2.0

psma7 – XORFeome 2.0

General Information

Species: Xenopus tropicalis proteasome (prosome, macropain) subunit, alpha type 7, mRNA (cDNA clone MGC:75728 IMAGE:5381021), complete cds
Gene Symbol: psma7
Gene ID: 394668
ORF gb_acc: MG132947
ORF ID: 10321

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061282

Library Location

Plate ID: GDExt11003
Well Location: D06

EST Sequences

Clone: MGC:75728 IMAGE:5381021
Trimmed Sequence: ATGAGTTACGATCGGGCGATCACTGTCTTCTCCCCGGATGGGCACCTCTTCCAGGTGGAATATGCGCAGGAGGCCGTCAAGAAAGGATCCACAGCCGTTGGCGTTCGTGGCAAGGAGATTGTGGTTCTGGGAGTGGAAAAGAAATCGGTAGCGAAGCTCCAGGATGAGAGGACGGTGCGCAAAATCTGCGCCTTGGATGAAAACGTCTTTATGGCCTTTGCTGGTCTCACAGCTGACGCTCGAATTGTTATAAACCGCGCTCGGGTCGAATGCCAGAGCCACCGGCTGACAGTGGAGGATCCGGTAACGGTGGAGTACATTACCCGTTACATCGCCAGCCTAAAGCAGCGCTACACACAGAGCAACGGACGCCGTCCTTTCGGGATCTCTGCTCTCATTGTGGGATTTGATTTCGATGGGACCCCTCGCCTCTACCAGACAGATCCCTCCGGGACGTACCACGCCTGGAAGGCCAATGCCATTGGCAGGGGTGCCAAATCTGTACGGGAGTTTTTGGAGAAGCACTACACCGACGAAGCCATCGAGACTGACGACCTGACCATTAAACTAGTAATCAAGGCTTTGCTTGAGGTAGTACAGTCCGGAGGTAAAAACATAGAGCTGGCAGTTATGAGGAGAGACCAGCCACTCAAGATACTGAACCCCGAAGAAATCGAGAGGTACGTCGCCGAAATCGAGAAAGAGAAGGAGGAGAACGAGAAGAAGAAGCAGAAGAAGACGACATAA
Full Trace Sequence: gatgagtgcgctgttttgagcaggtttcggtttgtgagcggattgtcctcggagccaacatgagttacgatcgggcgatcactgtcttctccccggatgggcacctcttccaggtggaatatgcgcaggaggccgtcaagaaaggatccacagccgttggcgttcgtggcaaggagattgtggttctgggagtggaaaagaaatcggtagcgaagctccaggatgagaggacggtgcgcaaaatctgcgccttggatgaaaacgtctttatggcctttgctggtctcacagctgacgctcgaattgttataaaccgcgctcgggtcgaatgccagagccaccggctgacagtggaggatccggtaacggtggagtacattacccgttacatcgccagcctaaagcagcgctacacacagagcaacggacgccgtcctttcgggatctctgctctcattgtgggatttgatttcgatgggacccctcgcctctaccagacagatccctccgggacgtaccacgcctggaaggccaatgccattggcaggggtgccaaatctgtacgggagtttttggagaagcactacaccgacgaagccatcgagactgacgacctgaccattaaactagtaatcaaggctttgcttgaggtagtacagtccggaggtaaaaacatagagctggcagttatgaggagagaccagccactcaagatactgaaccccgaagaaatcgagaggtacgtcgccgaaatcgagaaagagaaggaggagaacgagaagaagaagcagaagaagacgacataacggccctcgttatattcgctcgttatacaataaatcatcttcttttctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSYDRAITVFSPDGHLFQVEYAQEAVKKGSTAVGVRGKEIVVLGVEKKSVAKLQDERTVRKICALDENVFMAFAGLTADARIVINRARVECQSHRLTVEDPVTVEYITRYIASLKQRYTQSNGRRPFGISALIVGFDFDGTPRLYQTDPSGTYHAWKANAIGRGAKSVREFLEKHYTDEAIETDDLTIKLVIKALLEVVQSGGKNIELAVMRRDQPLKILNPEEIERYVAEIEKEKEENEKKKQKKTT
Donor tissue: tadpole