ORFeome > ptafr – XORFeome 2.0

ptafr – XORFeome 2.0

General Information

Species: Xenopus tropicalis platelet-activating factor receptor, mRNA (cDNA clone MGC:79467 IMAGE:5384384), complete cds
Gene Symbol: ptafr
Gene ID: 493365
ORF gb_acc: MG133577
ORF ID: 11112

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080881

Library Location

Plate ID: GDExt11011
Well Location: G03

EST Sequences

Clone: MGC:79467 IMAGE:5384384
Trimmed Sequence: ATGTCTTCAGAGACAACTACAAACTACCTAAGTAAAACAGATCCTTGTAATGTGGATTCCACGTTCAGATACTCCCTCTTCACCGTGACCTATAGCATCATTTTTGTCTTCGGATTCATTGCCAACTGTTATGTCTTGTGGATATTTGGCAAAGTTTACCCTGCCAAGAATCTCAGTGAAATTAAAATTTTTATGATCAATTTGACAGTTGCAGACTTGCTGTTTTTAGTAACGCTTCCACTCTGGATTGTTTATTACCATTACGGAGGAGACTGGTTTATGCCTTCCTTTCTGTGCAATGTGGCAGGCTGCTTTTTTTTCCTCAACACATATTGTTCAGTGGCATTTCTAGGAGTCATAAGCTATAACCGATTCCAGGCTGTAACACGTCCAGTAGAAACTGCTCAGTCCACAGCAAGAATAAGAGGCATCTGTATCTCAGCAGCTGTATGGATCCTTTTGTTTGCCAGCTCACTGTATTTTCTTATTTTTCCTGGCACTAATGAAGTAAACATTAATGGTCAAAACTACACCCGATGTTTTGAAGGATACAGCATTGACAACAGGGAACCAGTGGCTGTTATCCATTTTATTCTGGTTGGGGCATTTTTTGTTGTGTTTCTAATCATATTAACCTGCAATCTGGTGATTGCCAGAACATTACTTACCCAGCCAGTGAAGTCGAGGAAAAGTTCAGATATGAAACATAGAGCTTTGTGGATGGTGGTCACTGTACTGGCTGTCTTTGTCATATGTTTTGTACCCCACCATATTGTAGATGGTCCTTGGACTCTGACAGTATTGAGAATGTGGCATGAAAGAGATTGTGAGTTTCGCTTGACACTGAACAATGCGCATCAAATAACACTGTGCCTTATGAGCACCAACTGTATGCTGGACCCTATAATCTACTGTTTCCTCACAAAGAAGTTCAGGAAACATCTCAGTGAGCGAATTCAGAACATTAAAAGCAGCCGTAAGTTGTCTAGAAATACCACTGACACCAACCTAGAGACCACATTGCCATTCAAAGAAAAGCTAGACAACATTACCAGTGTATAA
Full Trace Sequence: attgcaggtttcctgtacactgccccttacacacccttctgcctgctgagagtttatctgaaagatcagcagcatgcacatagagtatagatctggcacaatcactccctgcttggacttcttgcagactcattagccaagacaagtgcaaaacgggaatacaatgtcttcagagacaactacaaactacctaagtaaaacagatccttgtaatgtggattccacgttcagatactccctcttcaccgtgacctatagcatcatttttgtcttcggattcattgccaactgttatgtcttgtggatatttggcaaagtttaccctgccaagaatctcagtgaaattaaaatttttatgatcaatttgacagttgcagacttgctgtttttagtaacgcttccactctggattgtttattaccattacggaggagactggtttatgccttcctttctgtgcaatgtggcaggctgcttttttttcctcaacacatattgttcagtggcatttctaggagtcataagctataaccgattccaggctgtaacacgtccagtagaaactgctcagtccacagcaagaataagaggcatctgtatctcagcagctgtatggatccttttgtttgccagctcactgtattttcttatttttcctggcactaatgaagtaaacattaatggtcaaaactacacccgatgttttgaaggatacagcattgacaacagggaaccagtggctgttatccattttattctggttggggcattttttgttgtgtttctaatcatattaacctgcaatctggtgattgccagaacattacttacccagccagtgaagtcgaggaaaagttcagatatgaaacatagagctttgtggatggtggtcactgtactggctgtctttgtcatatgttttgtaccccaccatattgtagatggtccttggactctgacagtattgagaatgtggcatgaaagagattgtgagtttcgcttgacactgaacaatgcgcatcaaataacactgtgccttatgagcaccaactgtatgctggaccctataatctactgtttcctcacaaagaagttcaggaaacatctcagtgagcgaattcagaacattaaaagcagccgtaagttgtctagaaataccactgacaccaacctagagaccacattgccattcaaagaaaagctagacaacattaccagtgtataaatatgatctattttttctaataaatataatgtgggggaacacgtgatatagtttgctaatgctaacacagtaagggaagtaaaagaggaaacctaaagccttgctgtgagaaaatcacatgttataaatgactagaagactggcttaaggcttcgttagtatttgccttttgattctataaaggtttaaacaaataaatgctttaagaaaataggtacatttagagtctaaaggcttaattttaagtgctgttaatatttgcattttttttacttgatctatttgaaactctgaataattgaaagctggaggttatattaaatcttgagtgttattgtaccaaaaacctccataaaagcttttagagttgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSETTTNYLSKTDPCNVDSTFRYSLFTVTYSIIFVFGFIANCYVLWIFGKVYPAKNLSEIKIFMINLTVADLLFLVTLPLWIVYYHYGGDWFMPSFLCNVAGCFFFLNTYCSVAFLGVISYNRFQAVTRPVETAQSTARIRGICISAAVWILLFASSLYFLIFPGTNEVNINGQNYTRCFEGYSIDNREPVAVIHFILVGAFFVVFLIILTCNLVIARTLLTQPVKSRKSSDMKHRALWMVVTVLAVFVICFVPHHIVDGPWTLTVLRMWHERDCEFRLTLNNAHQITLCLMSTNCMLDPIIYCFLTKKFRKHLSERIQNIKSSRKLSRNTTDTNLETTLPFKEKLDNITSV
Donor tissue: neurula