ORFeome > qrich1 – XORFeome 2.0

qrich1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis glutamine-rich 1, mRNA (cDNA clone MGC:89757 IMAGE:7027431), complete cds
Gene Symbol: qrich1
Gene ID: 493333
ORF gb_acc: MG133172
ORF ID: 10626

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080472

Library Location

Plate ID: GDExt11006
Well Location: B03

EST Sequences

Clone: MGC:89757 IMAGE:7027431
Trimmed Sequence: ATGAATAATTCTTTGGAGAACACCATTTCGTTTGAAGAATATGTCCGCATGAAGGCCCGTACAGTTCCACAGCACAGGATGAAGGAGTTCCTGGAGTCACTGGCCTCAAAGGGACCTGAAGCCTTACAGGAATTTCAGCAGCCACCACCCACCACCACCATGGTCTATCAACAAGGGGCTAATTGCATCTATACAGACAGCACAGAGGTGGCAGGATCCTTACTTGAACTGGCTTGTCCTGTTACAAGTGTGCAGCAACAGCAAGTGCAGCAGGAACAGCAGATACAAGTTCAAGCACAACAGGTGCAGATTCATGAAGCACTCACCAGGCCTTGGAATCTTCTCCACCCTGCCCCACAGCTGAATCGAATGAACCTCTCCCCCGAGGGGTCCCAGGATTCTGGTATTTCAGAAGACATGTTGGTGCAGGTACAGCAGTCACCGCAGCAGGTAACGGGTCAACAGCTCTCGCCACAACTTAATGTTCATCCATCAAATGAGCAGCCAATTCAAGTGCAAGTACAAATCCAGGGTTCAGGACAGTCACAAACAGCGCAAACAATACAGAATCAGTCCCTGCAGAGCCAGACCCCTTCCCAGATGCAAGTGGCCCAGATTCAGGTCCAGCATGTTCAGGCTGGCCAGCAAATTCAGCCCTCTGATATGCAGGACGATCATATACAGCATCAGCAGATCCAAGCACAGCTAGTGGCAGGACAGTCTGTGGGCAGCGGTATCCAGATACAGCAAACAGCCAGTGCTCTTTCCCCTCCACCCACTCAGCAAGGCTCCCCACGGGAAGTGGAGCGCCGATCCAGCTCTTCGAGTGTCCTTCAGCCAGTAAAGAAGCGCAAAGTGGATATGCCAATCACTTTGTCATATGCAATCTCAGGACAGCCTGTTGCAGCTGTTTTGGCAATTCCACAAGGGCAGCAACAGAGTTATGTGTCTCTGAGGCCAGACTTACTAACAGTAGACAGTGCCCATCTCTATGGGGCCACTGGGACCATTACAAGCCCAACAGGAGAGACGTGGACCATCCCGGTCTACTCTGCTAATGCCCGCAGTGACCTACCGCAGCAGAACATAACCCACATAGCCATCCCTCCAGAGGCCTACAATGCTGTCCACGTTACAGGTTCCCCCACTGTGGCGGCTGTTAAATTAGAAGAGGAGAAGGACAAAATGGTCAAAAATACACACGAGGAAGTGGTGCAGACTCTTGCAAATTCTCTGTTTCCAGCTCAGTTCATGAATGGGAATATCCACATTCCAGTGGCTGTCCAGGCTGTGGCAGGGGCATACCAGAATACAGCACAGACTGTACATATTTGGGACCCTCAACAGCAAGCAACGCTACATGAGCAAGTTCAGCAGCATCAACAACAGCAACAACATCAGCTGCAGGCACAAGCTGTTAACGAAGTAGAACCACAACAGCAACCTTCTCCTGAACTTCTGCTTCCCAGTACCTTGAAACCAGAGGAAGGGCTTCAAGTATGGAAGAACTGGGCACAGACAAAGAATGCAGAGCTTGAAAAGGACTCCCAAAACAGATTAGCACCCATAGGAAGACGTCAGCTCCTAAGGTTTCAGGAAGATCTCATTTCCTCGGCAGTTGCAGAGTTAAATTATGGGCTGTGTCTAATGACTAAAGAGGCTCGCAACATGGAAGGTGAACCCTATGATGCTGACGTTCTCTACTACATTTTTCTGTGTATACAGAAGTACCTGTGTGAGAATGGAAGAGTAGACGACATATTTTCTGACAACTACTACATCAAGTTTACAGAGTGGCTTCATGAGGTTCTGAAAAATTATCAGCCCAGAGTCACTCCTATTGGATATGTGATCCCCAGCCATGTGACCGAGGAAATGCTTTGGGAGTGTAAGCAGCTGGGCGCCCACTCTCCTGCCACACTACTTACAACACTTATGTTTTTTAACACAAAATATTTTCTGTTAAAAACTGTTGACCAGCACATTAAATTGGCCTTCTCCAAAGTCCTAAGGCAAACGAAGAAAAATCCTTCCAATCCAAAGGATAAGAGCACGAGCATCCGGTACCTGAAAGCACTTGGGATCCATCAAGCAGGGCAGCAAAAAGGTTTCTCAATAACAGACGACATGTATGCAGAGCAAACAGAGAACCCAGAAAATCCATTACGATGTCCCATTAAATTGTATGACTTCTACCTCTTCAAATGCCCACAGAGTGTAAAAGGACGAAATGACACATTCTATTTGACGCCAGAACCAGTCGTAGCACCCAACAGTCCAATCTGGTATTCTACACAGCCAATCAGCAGAGAGCAAATGGAACAGATGCTAACCCGAATTCTGCTCATCCGAGAGATCCAGGAAGCCATTGTGGTTGCGAGTGCCAGCAACATGCACTAA
Full Trace Sequence: tgaatgtaagatggcgcccagggagctgtgaggcgaaaataatctatcggaaaaaaaggaataataatcacccgaagagggagcgggaggactgagcagagcccggggagccaagtgtgtggcagcggcaccggaggaggagagggccaagcggtgccggagtgaagctccctcctgacaaggagcgggcggagcagctggggatttgactcagttgtgtacgctatgaataattctttggagaacaccatttcgtttgaagaatatgtccgcatgaaggcccgtacagttccacagcacaggatgaaggagttcctggagtcactggcctcaaagggacctgaagccttacaggaatttcagcagccaccacccaccaccaccatggtctatcaacaaggggctaattgcatctatacagacagcacagaggtggcaggatccttacttgaactggcttgtcctgttacaagtgtgcagcaacagcaagtgcagcaggaacagcagatacaagttcaagcacaacaggtgcagattcatgaagcactcaccaggccttggaatcttctccaccctgccccacagctgaatcgaatgaacctctcccccgaggggtcccaggattctggtatttcagaagacatgttggtgcaggtacagcagtcaccgcagcaggtaacgggtcaacagctctcgccacaacttaatgttcatccatcaaatgagcagccaattcaagtgcaagtacaaatccagggttcaggacagtcacaaacagcgcaaacaatacagaatcagtccctgcagagccagaccccttcccagatgcaagtggcccagattcaggtccagcatgttcaggctggccagcaaattcagccctctgatatgcaggacgatcatatacagcatcagcagatccaagcacagctagtggcaggacagtctgtgggcagcggtatccagatacagcaaacagccagtgctctttcccctccacccactcagcaaggctccccacgggaagtggagcgccgatccagctcttcgagtgtccttcagccagtaaagaagcgcaaagtggatatgccaatcactttgtcatatgcaatctcaggacagcctgttgcagctgttttggcaattccacaagggcagcaacagagttatgtgtctctgaggccagacttactaacagtagacagtgcccatctctatggggccactgggaccattacaagcccaacaggagagacgtggaccatcccggtctactctgctaatgcccgcagtgacctaccgcagcagaacataacccacatagccatccctccagaggcctacaatgctgtccacgttacaggttcccccactgtggcggctgttaaattagaagaggagaaggacaaaatggtcaaaaatacacacgaggaagtggtgcagactcttgcaaattctctgtttccagctcagttcatgaatgggaatatccacattccagtggctgtccaggctgtggcaggggcataccagaatacagcacagactgtacatatttgggaccctcaacagcaagcaacgctacatgagcaagttcagcagcatcaacaacagcaacaacatcagctgcaggcacaagctgttaacgaagtagaaccacaacagcaaccttctcctgaacttctgcttcccagtaccttgaaaccagaggaagggcttcaagtatggaagaactgggcacagacaaagaatgcagagcttgaaaaggactcccaaaacagattagcacccataggaagacgtcagctcctaaggtttcaggaagatctcatttcctcggcagttgcagagttaaattatgggctgtgtctaatgactaaagaggctcgcaacatggaaggtgaaccctatgatgctgacgttctctactacatttttctgtgtatacagaagtacctgtgtgagaatggaagagtagacgacatattttctgacaactactacatcaagtttacagagtggcttcatgaggttctgaaaaattatcagcccagagtcactcctattggatatgtgatccccagccatgtgaccgaggaaatgctttgggagtgtaagcagctgggcgcccactctcctgccacactacttacaacacttatgttttttaacacaaaatattttctgttaaaaactgttgaccagcacattaaattggccttctccaaagtcctaaggcaaacgaagaaaaatccttccaatccaaaggataagagcacgagcatccggtacctgaaagcacttgggatccatcaagcagggcagcaaaaaggtttctcaataacagacgacatgtatgcagagcaaacagagaacccagaaaatccattacgatgtcccattaaattgtatgacttctacctcttcaaatgcccacagagtgtaaaaggacgaaatgacacattctatttgacgccagaaccagtcgtagcacccaacagtccaatctggtattctacacagccaatcagcagagagcaaatggaacagatgctaacccgaattctgctcatccgagagatccaggaagccattgtggttgcgagtgccagcaacatgcactaaatcattctttctgggcacagaagtcatgtaaaaggaagagaggaaataaagaaacctgtacagacttttacactatgagaagatgcctactttttctgttatttttattttattttttattggtgtagttatggagcccttttaggcttctcctgtttaaaataaagtgtaagtaaaagcgcccaaatgtgcatttaaagacaaaaaaaaatctgcgttcctaaatggctggaaagcgaaacggttattgttattttaaacctttttcccccccaccccatatccttttagcatggtctagaaatattttattttatttgggaaaagaaagaaggcatcttaggttgaatgggatggactgtgcagctgctcacgccattgcctaccacatatatggacgtttattctgtattttcagttgcagggccaagcgacccctggttttatataactacatatataaaaatatttcagaaaaagtcggattatttcacattaacctgaatatatttctttttttttttttttttcctggcccaaattatcaaggccttaaactgcaggcatatgagcctatgtaaatttattgtaatataatcttgtgtatctgctgcagatatctccatatttctccattgttcttatgctctttgttttattaagaatgacaagcacgtctttttaacatgaaaaaaaaaaaaaaaa
Translation: MNNSLENTISFEEYVRMKARTVPQHRMKEFLESLASKGPEALQEFQQPPPTTTMVYQQGANCIYTDSTEVAGSLLELACPVTSVQQQQVQQEQQIQVQAQQVQIHEALTRPWNLLHPAPQLNRMNLSPEGSQDSGISEDMLVQVQQSPQQVTGQQLSPQLNVHPSNEQPIQVQVQIQGSGQSQTAQTIQNQSLQSQTPSQMQVAQIQVQHVQAGQQIQPSDMQDDHIQHQQIQAQLVAGQSVGSGIQIQQTASALSPPPTQQGSPREVERRSSSSSVLQPVKKRKVDMPITLSYAISGQPVAAVLAIPQGQQQSYVSLRPDLLTVDSAHLYGATGTITSPTGETWTIPVYSANARSDLPQQNITHIAIPPEAYNAVHVTGSPTVAAVKLEEEKDKMVKNTHEEVVQTLANSLFPAQFMNGNIHIPVAVQAVAGAYQNTAQTVHIWDPQQQATLHEQVQQHQQQQQHQLQAQAVNEVEPQQQPSPELLLPSTLKPEEGLQVWKNWAQTKNAELEKDSQNRLAPIGRRQLLRFQEDLISSAVAELNYGLCLMTKEARNMEGEPYDADVLYYIFLCIQKYLCENGRVDDIFSDNYYIKFTEWLHEVLKNYQPRVTPIGYVIPSHVTEEMLWECKQLGAHSPATLLTTLMFFNTKYFLLKTVDQHIKLAFSKVLRQTKKNPSNPKDKSTSIRYLKALGIHQAGQQKGFSITDDMYAEQTENPENPLRCPIKLYDFYLFKCPQSVKGRNDTFYLTPEPVVAPNSPIWYSTQPISREQMEQMLTRILLIREIQEAIVVASASNMH
Donor tissue: