ORFeome > rab33b – XORFeome 2.0

rab33b – XORFeome 2.0

General Information

Species: Xenopus tropicalis RAB33B, member RAS oncogene family, mRNA (cDNA clone MGC:89341 IMAGE:6987788), complete cds
Gene Symbol: rab33b
Gene ID: 493471
ORF gb_acc: MG133906
ORF ID: 11499

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC081311

Library Location

Plate ID: GDExt11014
Well Location: H05

EST Sequences

Clone: MGC:89341 IMAGE:6987788
Trimmed Sequence: ATGTCAGCCGGCTCCGGTGGTGATGGAGGGTTGGAGTCCTCCCTGGAAGCAAGTATAAGCAGCTCTTGTTCGTTTGGTGTCTCCCGGGCCAGGATTTTTAAGATCATTGTGATTGGGGACTCAAATGTTGGAAAAACTTGTCTGACTTACCGATTTTGCACCTGCTGCTTTCCGGAAAGGACAGAAGCTACAATAGGGGTGGACTTTCGAGAAAGGACTGTGGATATAGATGGGGAAAGGATCAAGATTCAGCTGTGGGACACTGCAGGACAGGAACGTTTCCGTAAGAGTATGGTGCAGCATTACTACAGGAATGTGCATGCTGTAGTCTTTGTATATGATATCACCAATATGGCCAGTTTTCAGAGTTTACCTGCCTGGATTGAGGAGTGCAAACAGCACTTAATATCCAATGATGTGCCTCGTATTTTGGTTGGTAATAAATGTGACTTGCGAGGGTCTATCCAGGTTCCCACGGATATGGCTCAGAAGTTTGCTGACTCACACAGCATGCCAATGTTTGAAACTTCAGCCAAGAACACAAATGACCACGTGGAAGCCATCTTCATGACGCTGGCCCACAAACTCAAGAGCCACAAGCCACTAATTTTGAGCCAGCCTCCTGATAATATGGTGGAGTTGAATTCAGGTCCAAAGACTTTGTTTCCATGTGGCTGCTAG
Full Trace Sequence: ggggaaataatatgcggaatcatagggcagttttccacggatgccagttagcgctgctgtcggtcggaggggcttaggcaaagtcgcggaaacagcgcaactgctatcgcagcttctgactttgtgtcccggtgagagagtgactgctcggctttcccactcacaaccccacgcccaaagcttcaggacgtggcgcttgggcacagctggccgggagctgtctttgcgtgggattccctactcacatagcgggccgcattgtgaccataatgtcagccggctccggtggtgatggagggttggagtcctccctggaagcaagtataagcagctcttgttcgtttggtgtctcccgggccaggatttttaagatcattgtgattggggactcaaatgttggaaaaacttgtctgacttaccgattttgcacctgctgctttccggaaaggacagaagctacaataggggtggactttcgagaaaggactgtggatatagatggggaaaggatcaagattcagctgtgggacactgcaggacaggaacgtttccgtaagagtatggtgcagcattactacaggaatgtgcatgctgtagtctttgtatatgatatcaccaatatggccagttttcagagtttacctgcctggattgaggagtgcaaacagcacttaatatccaatgatgtgcctcgtattttggttggtaataaatgtgacttgcgagggtctatccaggttcccacggatatggctcagaagtttgctgactcacacagcatgccaatgtttgaaacttcagccaagaacacaaatgaccacgtggaagccatcttcatgacgctggcccacaaactcaagagccacaagccactaattttgagccagcctcctgataatatggtggagttgaattcaggtccaaagactttgtttccatgtggctgctaggatttattatttttataagatttatcaccaaaactgaactacattagaactttagactggactacaggttgcagttgtttggaggttgcatggattctctgataatatgacctaggcctttaaagtcatgggaattttcatatctgcatgattttatttttaggattgctacctcgtcagcatctgtgcaccaaattgcttgcattctacatctgataactcagcattgtgtaataatttatactaggatgcagatttgccctgtgctaaaaggttttgcttactcagagaccctaattttaataattaaagaaaaggaagtaattatgcatttgagctatgctatcttcatatggctttcaaacaacttgatcatttcaacattgatttttataactggagcttcatgatgatatatgtgctgattgttagatcttccttttgttgtgtttactgcttttagtttttgcttgtacacaataacgccatatgtgtgtaaaactgactgctttaccttattagattaatcagtgcattaacgggcagtatcttgtttttacataaaacatccttcgtgcatagacatccttaatgttttaaggccaagtattaaagcagcagtgtctagatatgcagctatggataatctacatttccagcatctctatgccaccactgatggtggaagatttatggaggttgtagttcagccatagctgtggttctatacagtaactattcatcaatcaagtgtagacatagattgtaatgtaaatgaattgagagtaaattaattgagatgctatagaagccaatattcagacttagttaacctagggcagtggtggttcttaatcctgtactttggatagtcccaaagctccacacatggatccacatataatatgtatgaaaacctgttttaagagggggtggggcaaagtctggggatgggcccaataattttccttctaatgcatttttacctttttttaaactcaaatgtacctgctgccttgcttactagaaatttgtattggcttctatacatttaaatagtgatcagcctagcagtatggcagtattaccgctgcctgggtgatacatgggttggcagtctttgatccagcatatgttgcacttgtgcattctcatactaatatactacatctaactcttttccctctttgttactattcagatcagttttattttctgttcataaatgtgtaggggcctgagtattctggtgctgggctgattcatgttatgttttaggagattttaacaagaagtttgctggtgttttttattttgccttagaatcagaatcaaggtctagtcaaggatattggtatgttaacagggcctggccattcagagcattataatattataacacaatcattatgagaaccaacaacaaattggagcattttttaattgtcatttatcatgcttccaaaaatgttacctttgtttttctatcttttttttttgcggggggggggtctattgtaaacataagtggggtttatattgatgtattgatattaaagctctagctcaatgctgcctcaaaatgaactgtttatccataaatgaatgaaacaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSAGSGGDGGLESSLEASISSSCSFGVSRARIFKIIVIGDSNVGKTCLTYRFCTCCFPERTEATIGVDFRERTVDIDGERIKIQLWDTAGQERFRKSMVQHYYRNVHAVVFVYDITNMASFQSLPAWIEECKQHLISNDVPRILVGNKCDLRGSIQVPTDMAQKFADSHSMPMFETSAKNTNDHVEAIFMTLAHKLKSHKPLILSQPPDNMVELNSGPKTLFPCGC
Donor tissue: gastrula