ORFeome > racgap1 – XORFeome 2.0

racgap1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Rac GTPase activating protein 1, mRNA (cDNA clone MGC:69444 IMAGE:5335860), complete cds
Gene Symbol: racgap1
Gene ID: 407917
ORF gb_acc: MG133300
ORF ID: 10792

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067994

Library Location

Plate ID: GDExt11007
Well Location: F09

EST Sequences

Clone: MGC:69444 IMAGE:5335860
Trimmed Sequence: ATGGCGACAAACCTGATGAACCTACGCAATCTTTTTGAGCAATTAATGCGGCAAGTAGATGGCCTGAATGAGGGTATAGAGCCACAGTTTATTCAGCTGGCTAAGAATTTTGAAGACTTTCGAAGAAAATGGCAAAAATCTGAGCAAGAACTGATAAAAAATAAAGAAATGCTGATGAAGACTGAAACTGAGCGCAGTGCGCTGGAAGTTAAGCTAAAGCATGCACGCAATCAGGTGGATGTGGAGATAAAGAGGAGACAACGTGCAGAGGTGGAATGTGAAAAACTGGAACGACAAATACAGCTGATACGGGAACTGCTAATGTGTGATCCATCTGGCAGCATTCAGCTCAGTGAGCAGCAAAGAAGTGCTTTAGCTTTTCTTAATAACAGGACTCAAATGTCCGCTGATGGAAATGGCACTAGGAGGCTCTCAACAATAGATGAATCTGCTTCCATTCTCTCAGACATCAGCTTTGACAAGACTGAAGACTCATTGGACTGGGATTCTTCTCTTGTACGAAATGTGCGGCTTAAGAAACGAGAGAAACGGCGTTCCTCCAGGCAGCATACTGAAGGACCACCAGTTCCAAGCAAGAGAAATCGTTCTATAGAAATTGCAATGGATCAGGCCAATGAATCCATTATTGCAAAAACAACGCTTACTGTGCCAAACAATGGAGGGCCTATTGATGTTGTTTCTTCAATTGAGACTGTACCATATTATAACACTCGGAGCCGTAGGACTGGAACACTGCAGCCCTGGAACAGTGATTCCAGTTTAGTGAGTCGGCACCTTGACCATAAAGGTGAAGCAGACACTTGCAGAACTCCACAGAATGGAGGCATGCGTCTACATGAATTTGTATCAAAAACGGTAATTAAACCTGAGTCGTGTGTTCCATGCGGTAAAAGAATAAAATTTGGAAAAATTTCTTTGAAGTGTCGCGATTGTCGTGTTGTAGCTCATCCAGAGTGTCGAGAACGATGCCCCCTTCCCTGTATTCCTACAGTGGGTGGCACACCTGTCCGTATTGGAGAGGGCACCCTAGCGGATTTTGCTCCACTGACATCTCCAATGATTCCTCCAATAATTGTTCACTGTGTCAGTGAAATTCAGCAGAGAGGACTCCATGAGACTGGTTTGTATCGAATTTCTGGCTGCGACCGTACAGTGAAGGAACTTAAGGAAAAGTTCCTCAGAGGAAAGAGTGTTCCTCTTCTAAGTAAAGTGGATGATATTCATGCCGTGTGTGGATTCCTGAAGGACTTTCTGAGGAATCTCAAGGAGCCACTTCTCACTTTCCGGCTAAATAGAGTTTTCATGGAAGCAGCTGAAATTACAGATGAAAAGAGCAGCATTGCTGCTATTTACCAAGCTGTAGATGAGTTGCCAGCACCCAACAGAGACACGCTAGCTTACTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCCCAGACTGTAAGATGGATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCATGCAGTGCCAGATCCTGACCCCATGACAATTCTTCAAGATACAAGGCGACAACCTATGGTTGTTGAAAGGCTGATGCTATTACCTGCAGAATTCTGGAATCAGTTCATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATGCCAATGTTTTTAACACTCCTCGGACTCCTGACGCCAGAGTCAGCATGTTAGGACCCCTTACCACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTTTCTCAGAGGATGAAATCCACAATTGGCAAAAACACACCAATGTTTGGAAGCAAAAGTAAATCCGTAAGCAGCATCCCCAGACAAGGAAACTTTTTCGCCTCCCCTCTGCTTAAATAA
Full Trace Sequence: gctggggagccgcggcagggatccggctcggcgcctctataaagtgctggcctgcagtgtgaccgggggaaccgcgcgaagatggcgacaaacctgatgaacctacgcaatctttttgagcaattaatgcggcaagtagatggcctgaatgagggtatagagccacagtttattcagctggctaagaattttgaagactttcgaagaaaatggcaaaaatctgagcaagaactgataaaaaataaagaaatgctgatgaagactgaaactgagcgcagtgcgctggaagttaagctaaagcatgcacgcaatcaggtggatgtggagataaagaggagacaacgtgcagaggtggaatgtgaaaaactggaacgacaaatacagctgatacgggaactgctaatgtgtgatccatctggcagcattcagctcagtgagcagcaaagaagtgctttagcttttcttaataacaggactcaaatgtccgctgatggaaatggcactaggaggctctcaacaatagatgaatctgcttccattctctcagacatcagctttgacaagactgaagactcattggactgggattcttctcttgtacgaaatgtgcggcttaagaaacgagagaaacggcgttcctccaggcagcatactgaaggaccaccagttccaagcaagagaaatcgttctatagaaattgcaatggatcaggccaatgaatccattattgcaaaaacaacgcttactgtgccaaacaatggagggcctattgatgttgtttcttcaattgagactgtaccatattataacactcggagccgtaggactggaacactgcagccctggaacagtgattccagtttagtgagtcggcaccttgaccataaaggtgaagcagacacttgcagaactccacagaatggaggcatgcgtctacatgaatttgtatcaaaaacggtaattaaacctgagtcgtgtgttccatgcggtaaaagaataaaatttggaaaaatttctttgaagtgtcgcgattgtcgtgttgtagctcatccagagtgtcgagaacgatgcccccttccctgtattcctacagtgggtggcacacctgtccgtattggagagggcaccctagcggattttgctccactgacatctccaatgattcctccaataattgttcactgtgtcagtgaaattcagcagagaggactccatgagactggtttgtatcgaatttctggctgcgaccgtacagtgaaggaacttaaggaaaagttcctcagaggaaagagtgttcctcttctaagtaaagtggatgatattcatgccgtgtgtggattcctgaaggactttctgaggaatctcaaggagccacttctcactttccggctaaatagagttttcatggaagcagctgaaattacagatgaaaagagcagcattgctgctatttaccaagctgtagatgagttgccagcacccaacagagacacgctagcttacttgatgatccatcttcaaagagtggcccagagcccagactgtaagatggatgtgagcaatctgtccaaggtatttggcccaactcttgttggtcatgcagtgccagatcctgaccccatgacaattcttcaagatacaaggcgacaacctatggttgttgaaaggctgatgctattacctgcagaattctggaatcagttcatgatggtagaaaatattgaccccaatcacattattgaaaatgccaatgtttttaacactcctcggactcctgacgccagagtcagcatgttaggaccccttaccactccagagcaacaattcaataaaactccatcatccagctccctttctcagaggatgaaatccacaattggcaaaaacacaccaatgtttggaagcaaaagtaaatccgtaagcagcatccccagacaaggaaactttttcgcctcccctctgcttaaataaaaagtccggagggtgcaagttatacactactcctggtgtctactaatctacacttgcttttaaacacttttaatgcattttaccgaagggatatatatataaaacattgtactgtattgcaagtatgctgccagccattaacaattttataactgcatttttatcattttagttggctgctataaaatcttcattgtagaaaactcattttaagtttttaattgttgtaaattgttttatcacaaggtctacatgttttgttttccaattatattggtgtgagcaagcacacaatacggtttgacataaatctcctaaatcttgaattgtaggacattttggaaaagtacccttatccttctgtaaatatttttagaaaaaaaagaacagttaaactgtgcagtgaatccaagatgttgtattaaccaacataattcatgtttagctttttagtatgttatgttgtgtaatactctgtaaatacaatactgctaaattatcaaaaaaaaaaaaaaaaaaaaaa
Translation: MATNLMNLRNLFEQLMRQVDGLNEGIEPQFIQLAKNFEDFRRKWQKSEQELIKNKEMLMKTETERSALEVKLKHARNQVDVEIKRRQRAEVECEKLERQIQLIRELLMCDPSGSIQLSEQQRSALAFLNNRTQMSADGNGTRRLSTIDESASILSDISFDKTEDSLDWDSSLVRNVRLKKREKRRSSRQHTEGPPVPSKRNRSIEIAMDQANESIIAKTTLTVPNNGGPIDVVSSIETVPYYNTRSRRTGTLQPWNSDSSLVSRHLDHKGEADTCRTPQNGGMRLHEFVSKTVIKPESCVPCGKRIKFGKISLKCRDCRVVAHPECRERCPLPCIPTVGGTPVRIGEGTLADFAPLTSPMIPPIIVHCVSEIQQRGLHETGLYRISGCDRTVKELKEKFLRGKSVPLLSKVDDIHAVCGFLKDFLRNLKEPLLTFRLNRVFMEAAEITDEKSSIAAIYQAVDELPAPNRDTLAYLMIHLQRVAQSPDCKMDVSNLSKVFGPTLVGHAVPDPDPMTILQDTRRQPMVVERLMLLPAEFWNQFMMVENIDPNHIIENANVFNTPRTPDARVSMLGPLTTPEQQFNKTPSSSSLSQRMKSTIGKNTPMFGSKSKSVSSIPRQGNFFASPLLK
Donor tissue: tailbud