ORFeome > rbm13 – XORFeome 2.0

rbm13 – XORFeome 2.0

General Information

Species: Xenopus tropicalis RNA binding motif protein 13, mRNA (cDNA clone MGC:75652 IMAGE:5379641), complete cds
Gene Symbol: rbm13
Gene ID: 394523
ORF gb_acc: MG132785
ORF ID: 10105

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061599

Library Location

Plate ID: GDExt11001
Well Location: E12

EST Sequences

Clone: MGC:75652 IMAGE:5379641
Trimmed Sequence: ATGCAGCACGATGATGTTATCTGGGATGTGGTTGGGAACAAGCAGTTCTGTTCATTCAAAATAAAAACAAAGACACAGAACTTCTGCCGCAATGAATACAACATAACTGGGCTGTGCAATCGCTCAGCCTGCCCCCTAGCCAACAGCCAGTATGCCACCATCAAAGAGGAGAAAGGCATCTGCTATTTGTATATGAAGACCATAGAGAGAGCAGCCTTTCCAGCTCGGATGTGGGAGAGGGTACGACTGAGTAAGAATTACGAGCAGGCGCTGGAACAGATCGACGAGAGCCTGATCTATTGGCCGCGCTTTATCAGGCACAAGTGCAAGCAAAGGTTCACCAAAATCACCCAGTACTTGATCCGCATCCGCAAGCTCACACTCAAGAGGCAGCGCAAGCTGGTTCCCCTAAGCAGGAAGGTGGAGAGGAGAGAAAAGCGGAGAGAGGAAAAGGCCCTGGTGGCTGCCCAGCTGGACAATGCGATAGAGAAGGAATTACTGGAGCGTCTCAAACAGGGAGCGTATGGAGATATCTATAACTTCCCCATTCAAGCTTTTGATAAAGCACTGGAACAACAGGAAGATGCAAGTGCCTCTGAGTCATCTGAGGAAGAAGAGGAGGAAGATGATGAAGAGAGCGGCAAGAGGGAGTTTGTGGAAGATGAAGATGTTGATGAAAGTGACCTGAGTGATTTTGAGGACATGGATAAACTTGGGGCCAGCAGTGAAGAGGAAAAGTCTTCCGGTGAGGAAGAGTCATCTGAGGAAGAAGAAGAAAAGGCCCCCAAAGCAAAGTCAAAAGGCAAAGCCCCAGTGAAAGGACAATTAATCAGGAAACGCCAGCATGTGGAGATAGAGTACGAACAAGAAACAGAGCCACAGCATAAAGCCAAAGTGACATAA
Full Trace Sequence: cgcactgaggcgctacacgcgttaccggctctggggtgagacacgtgatctaagcagccgccgggatgcagcacgatgatgttatctgggatgtggttgggaacaagcagttctgttcattcaaaataaaaacaaagacacagaacttctgccgcaatgaatacaacataactgggctgtgcaatcgctcagcctgccccctagccaacagccagtatgccaccatcaaagaggagaaaggcatctgctatttgtatatgaagaccatagagagagcagcctttccagctcggatgtgggagagggtacgactgagtaagaattacgagcaggcgctggaacagatcgacgagagcctgatctattggccgcgctttatcaggcacaagtgcaagcaaaggttcaccaaaatcacccagtacttgatccgcatccgcaagctcacactcaagaggcagcgcaagctggttcccctaagcaggaaggtggagaggagagaaaagcggagagaggaaaaggccctggtggctgcccagctggacaatgcgatagagaaggaattactggagcgtctcaaacagggagcgtatggagatatctataacttccccattcaagcttttgataaagcactggaacaacaggaagatgcaagtgcctctgagtcatctgaggaagaagaggaggaagatgatgaagagagcggcaagagggagtttgtggaagatgaagatgttgatgaaagtgacctgagtgattttgaggacatggataaacttggggccagcagtgaagaggaaaagtcttccggtgaggaagagtcatctgaggaagaagaagaaaaggcccccaaagcaaagtcaaaaggcaaagccccagtgaaaggacaattaatcaggaaacgccagcatgtggagatagagtacgaacaagaaacagagccacagcataaagccaaagtgacataaatccaccacctgaggcgcttgcaactgttcagaactctcttttctaaataaacccctattccccacccggcccactgttttgtaattcaaagatgaactgtaagaacagcccctcattgtgccctgcactcgccatcagaattactggggtttggaggaaggaaccaacaaaaataacggttttgatatatcagggcttgtaacatatggggttatgttcttaatgatatcacacgtgaatgtggctctttaacccacttttgctgtaagtttgacattcctgcctctaggtgctgttttatagagagttcagtggtttttagatacctagatcaggaaagtgaccaatacagagtggttgagtccatgcaaattaaaatgactgctcagattaccaaaaaaaaaaaaaaaaaaa
Translation: MQHDDVIWDVVGNKQFCSFKIKTKTQNFCRNEYNITGLCNRSACPLANSQYATIKEEKGICYLYMKTIERAAFPARMWERVRLSKNYEQALEQIDESLIYWPRFIRHKCKQRFTKITQYLIRIRKLTLKRQRKLVPLSRKVERREKRREEKALVAAQLDNAIEKELLERLKQGAYGDIYNFPIQAFDKALEQQEDASASESSEEEEEEDDEESGKREFVEDEDVDESDLSDFEDMDKLGASSEEEKSSGEEESSEEEEEKAPKAKSKGKAPVKGQLIRKRQHVEIEYEQETEPQHKAKVT
Donor tissue: tailbud