ORFeome > rbm14 – XORFeome 2.0

rbm14 – XORFeome 2.0

General Information

Species: Xenopus tropicalis RNA binding motif protein 14, mRNA (cDNA clone MGC:75876 IMAGE:5383053), complete cds
Gene Symbol: rbm14
Gene ID: 394647
ORF gb_acc: MG132993
ORF ID: 10376

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061344

Library Location

Plate ID: GDExt11004
Well Location: H10

EST Sequences

Clone: MGC:75876 IMAGE:5383053
Trimmed Sequence: ATGCCGAACTACGACGAGAGAATGAAGATATTTGTCGGTAATGTGGATGACAGCACAACGCAGGAGGAGATCACGGAGCTGTTCGAGCGCTACGGCACTGTAGTGAACTGCGCCGTCATGAAGCAATACGCCTTTGTCCACATGCGCGGCTCGGAGGAGGCGACCAAGGCCGTCGAGGATCTGAATGGCCGAGAGCTTAATGGCAAAAAAATGTTAGTCGAGCTGTCTAAGCCTCGGCCTCAAAACACTTGGAAAATATTCGTGGGGAACGTTAGTTCCTCCTGCGAAGTGTCCGAAATCCGCAAAATGTTCGAGGAACACGGGAGGGTGGTGGAATGTGACATAGTGAAAGATTATGCGTTTGTTCATATGACGAGAGAAAGTGAATCTAGGGCTGCTATTGAGGCTTTGAATGGAAAGGAAGTTAAAGGAAAGAGAATCAATGTGGAAATGTCTCATAAAGTCAGACCAGTGGCTGCTAATGGTAGTTCCCATAGTAGACGCCGACCAGATGATCGGGAAGCACCACAGAGTCGCGAATCATACAACCACAGAAGAGCCACTGAAGCAGCATATGCCTCTTATGCCCTTAAGTCCAATTATGAAAGATATGCACCAGAATCCTCTCGCTATGACCTTTACGAAAGTAGACCTCGTCCAACATCGCCAATGTATTATGCAAGGGACAGGAGTCCCATGCGTCGACCAGACTATGCTTTATCACAGACTGCTGCTCTAGCATCAAAGTACCGGTCTGAGGCAGCAGGTTTTGGGAACTTGGCTTCTGGTTATTCAGGCCAGGCTTCTGCTCTGGCCTCTTCTTACAGTAATCAGGCTTCTGCATTGGCTTCTTCCTACAACAATCAAAGAGCTTACACCAGTTCAGCTTCTGGATATGGCACAGATCAAATTGCTGCTTACAGCACCCAACCTTCTGCCTACGCTAATCAAGGTTCCTCCATCTATGGTACACAGGCTGCTTCCCTGGCTTCGTCCTATGGCAGCCAGCCTTCACATTTGTCTGCTTCCCCTTATGCGTCATCTGTAGTGCCCAGCGCTTATCGGCAGCAGCAGGGCTCTGCCTATGAGACCACTCAACTTGCCTCTCTTGGTCAACAGACTATGCCTTCAACCAATCCGATGTATGAACGCACGCGTCTTTCCCCGCCACGGGCTGCTATATCTGACAGCTACAAAAAGGCAGCTGACATTCAAAGGTATGCTACAGACCGCCGTTTTACCGACTTATCCGATTACCGCCGTTTATCCGAGTTGTCTGCTGCCTACCGCCAATCTCCGCCCAGGTCTACACTGGAATATCGCCGCCCAGAAACTCAGTCTGATTACGCATTAAGTGAATACTTCCGTGCAGCTCAGCTTCATGCTGGCTACCCCCGCCGTTTATAA
Full Trace Sequence: ggggttgcgcagattaataaagactctggtttacacatacgtttgggtgtgtgtaatttggagatctttgctcgggttatttttttttctcctgaggttccatctctgaccaatttaataccaacctagtattttttcccctttcttaattgtttccaaagtatttttaaaagtcggtattgtaggagacaattggtctttgtttccgtagtttttccacctaacctggttttgcggcgagccttagttttgcggtctcttaactagctatcgggaattattacattagcaatgccgaactacgacgagagaatgaagatatttgtcggtaatgtggatgacagcacaacgcaggaggagatcacggagctgttcgagcgctacggcactgtagtgaactgcgccgtcatgaagcaatacgcctttgtccacatgcgcggctcggaggaggcgaccaaggccgtcgaggatctgaatggccgagagcttaatggcaaaaaaatgttagtcgagctgtctaagcctcggcctcaaaacacttggaaaatattcgtggggaacgttagttcctcctgcgaagtgtccgaaatccgcaaaatgttcgaggaacacgggagggtggtggaatgtgacatagtgaaagattatgcgtttgttcatatgacgagagaaagtgaatctagggctgctattgaggctttgaatggaaaggaagttaaaggaaagagaatcaatgtggaaatgtctcataaagtcagaccagtggctgctaatggtagttcccatagtagacgccgaccagatgatcgggaagcaccacagagtcgcgaatcatacaaccacagaagagccactgaagcagcatatgcctcttatgcccttaagtccaattatgaaagatatgcaccagaatcctctcgctatgacctttacgaaagtagacctcgtccaacatcgccaatgtattatgcaagggacaggagtcccatgcgtcgaccagactatgctttatcacagactgctgctctagcatcaaagtaccggtctgaggcagcaggttttgggaacttggcttctggttattcaggccaggcttctgctctggcctcttcttacagtaatcaggcttctgcattggcttcttcctacaacaatcaaagagcttacaccagttcagcttctggatatggcacagatcaaattgctgcttacagcacccaaccttctgcctacgctaatcaaggttcctccatctatggtacacaggctgcttccctggcttcgtcctatggcagccagccttcacatttgtctgcttccccttatgcgtcatctgtagtgcccagcgcttatcggcagcagcagggctctgcctatgagaccactcaacttgcctctcttggtcaacagactatgccttcaaccaatccgatgtatgaacgcacgcgtctttccccgccacgggctgctatatctgacagctacaaaaaggcagctgacattcaaaggtatgctacagaccgccgttttaccgacttatccgattaccgccgtttatccgagttgtctgctgcctaccgccaatctccgcccaggtctacactggaatatcgccgcccagaaactcagtctgattacgcattaagtgaatacttccgtgcagctcagcttcatgctggctacccccgccgtttataatatgcgctcagtgctagctgtacgtttaggttgtgtacaaattgaatatcaaagcaatcatatagtatctttagtgtgttttagtttatccaagcttcagtgtttatacaatttttataagccatgttatcttgctgaatacatttataaccattgactttatacataggtacctggttatttttttttttcatcaatgtttgattttcagtctctatgagaaccttcagttttagtgtgcaccattcatccacaggttacaggtacatttctaccctacattgtgcttatatagacaagtcaaattgcattatcattcatttcctatacaagtagcgtgctgtaacattcatcacaagttatgttcaagcttctttttgtagtcccctaagtgaaggatgctacttcctgaccgatattttacaaaaatagtatcaacattctttacctaataaaccatgtaaggtgtcttgaaggggaagttaacctttaggttgacttttgcatataggtcccattactgacatttgctgtttctaacattgctggtttgcttaagttaaaataagttacacaggctttaaaaatgcatgctgttatgttttaaacaatccaaataaagtactcaactgccttatgccatgacataagagaatctttcactgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPNYDERMKIFVGNVDDSTTQEEITELFERYGTVVNCAVMKQYAFVHMRGSEEATKAVEDLNGRELNGKKMLVELSKPRPQNTWKIFVGNVSSSCEVSEIRKMFEEHGRVVECDIVKDYAFVHMTRESESRAAIEALNGKEVKGKRINVEMSHKVRPVAANGSSHSRRRPDDREAPQSRESYNHRRATEAAYASYALKSNYERYAPESSRYDLYESRPRPTSPMYYARDRSPMRRPDYALSQTAALASKYRSEAAGFGNLASGYSGQASALASSYSNQASALASSYNNQRAYTSSASGYGTDQIAAYSTQPSAYANQGSSIYGTQAASLASSYGSQPSHLSASPYASSVVPSAYRQQQGSAYETTQLASLGQQTMPSTNPMYERTRLSPPRAAISDSYKKAADIQRYATDRRFTDLSDYRRLSELSAAYRQSPPRSTLEYRRPETQSDYALSEYFRAAQLHAGYPRRL
Donor tissue: neurula