ORFeome > rbm4b – XORFeome 2.0

rbm4b – XORFeome 2.0

General Information

Species: Xenopus tropicalis RNA binding motif protein 4B, mRNA (cDNA clone MGC:75893 IMAGE:5383361), complete cds
Gene Symbol: rbm4b
Gene ID: 394812
ORF gb_acc: MG133003
ORF ID: 10390

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063354

Library Location

Plate ID: GDExt11004
Well Location: B12

EST Sequences

Clone: MGC:75893 IMAGE:5383361
Trimmed Sequence: ATGGTCAAGTTATTTGTTGGCAATCTGCCTCCTGAGGCCACGCAGTCAGAGCTGAAGTCATTGTTTGAGCAATTTGGCCGTGTGACAGAGTGTGATATCATTAAGAATTATGGCTTTGTCCATATGGAGGACAGAAAGGCAGCAGATGAAGCTGTGCATAATTTAAACCATTACAAGCTACATAGCGTTCCTATCAATGTGGAACACAGTAGAGGCAAGCCTAAGGCCTCGACTAAGCTACATGTAAGCAACCTCAGCACCAGTTGCACCAGTGAGGAGCTGCGTGCCAAATTTGAAGAGTATGGTGCTGTGCTGGAGTGTGATATTGTTAAGGATTATGCCTTTGTCCACATGGAGAGGTCGGCTGAAGCACTGGATGCCATAAAGAACCTAGACAACACTGAATTCAAAGGCAAACGGATGCATGTGCAGCTCTCAACAAGCCGTCTGCGAGTCACCCCGGGGATGGGAGAGAGGACTCGATGCTATCGTTGCGGAAAAGAGGGCCACTGGTCCAAAGAGTGCCCCCTAGACCAAATGACCAAGGAGCTGGAACAGGCGCCGGGCTACCCCCCTGAATCATTTCCAGATCCTTATGGCCCCATGCGCAGCGCAGCTGCTGCGTACAGAACGGCCTATGCTCACCGTGTTTTCTATGATGAGCGAGAACGGTTTAGCATCGTTGACTACTACCAACGCTACCGTGTGCGGCCCTCCTCCTATGATGCCTTAATTGAAAGACGGCTGACTGCTCTTCCTTCTGCAGCCACCACAGTATCATACCGGGAACGGATTGAATCTTTCCCATATGAGAGGCATTTACTACCCCCTCCACCCGAACTCCCCAGCTCCTATTACCCGCGTGAGCGTAGCCCTTTACGTCGCTCCTCCTCTGCTTCCTCCAGTATGGAGATATACCGAACCGAGCGCCGACTCTCCCCCATTATGCGAAGTCCCTTCGTTGATGACCCTCGATGCAGCAGAGAGTCCTACTATGAGCGGGTGCAATATTTGTAA
Full Trace Sequence: gttgggtgtgccggagtggctgactggcgactgtctgtggctaagggtggcccagccgaagaaccgtcctttgagaaacaacagattgtgaagttatggtcaagttatttgttggcaatctgcctcctgaggccacgcagtcagagctgaagtcattgtttgagcaatttggccgtgtgacagagtgtgatatcattaagaattatggctttgtccatatggaggacagaaaggcagcagatgaagctgtgcataatttaaaccattacaagctacatagcgttcctatcaatgtggaacacagtagaggcaagcctaaggcctcgactaagctacatgtaagcaacctcagcaccagttgcaccagtgaggagctgcgtgccaaatttgaagagtatggtgctgtgctggagtgtgatattgttaaggattatgcctttgtccacatggagaggtcggctgaagcactggatgccataaagaacctagacaacactgaattcaaaggcaaacggatgcatgtgcagctctcaacaagccgtctgcgagtcaccccggggatgggagagaggactcgatgctatcgttgcggaaaagagggccactggtccaaagagtgccccctagaccaaatgaccaaggagctggaacaggcgccgggctacccccctgaatcatttccagatccttatggccccatgcgcagcgcagctgctgcgtacagaacggcctatgctcaccgtgttttctatgatgagcgagaacggtttagcatcgttgactactaccaacgctaccgtgtgcggccctcctcctatgatgccttaattgaaagacggctgactgctcttccttctgcagccaccacagtatcataccgggaacggattgaatctttcccatatgagaggcatttactaccccctccacccgaactccccagctcctattacccgcgtgagcgtagccctttacgtcgctcctcctctgcttcctccagtatggagatataccgaaccgagcgccgactctcccccattatgcgaagtcccttcgttgatgaccctcgatgcagcagagagtcctactatgagcgggtgcaatatttgtaatctgtgaaggtaagatattttcgggctccgacgcggtctgcagttcgttgcgtttgcattaaattcttacctcggttcttcgaaatttgccaaccctcaactaatgtttcgctttttattttttttttaaggtagaatatgagctgtgggttttttttttttagtttttctttccgcaacccagttttttaacatttatttagccggctgtctttcaattctagaagggtagtaggtaaaggctaaagttcattttgactgaaaactaatggcagtgctgtccatttctccatagaggggcgtaaagtgtcttttaactttctttttttttttttatcgataaaatgagtttaacttaagctgcagtgtactttaaaacattgctgagccaaatattagaattttgtgtagtaatatttaagttgacaaaaggatttcactgcaatttacttaagtagacaatttacctctttatttactttgcagcagaaaagtggttgtgatattttccccttatataatgatatataatgataacacgcatccaaaaattgcagttgcgttgttcctctttgtattgtctaactttgtggagcatatgttaacgttgaacatctatttccatgaataaagcattgctctaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVKLFVGNLPPEATQSELKSLFEQFGRVTECDIIKNYGFVHMEDRKAADEAVHNLNHYKLHSVPINVEHSRGKPKASTKLHVSNLSTSCTSEELRAKFEEYGAVLECDIVKDYAFVHMERSAEALDAIKNLDNTEFKGKRMHVQLSTSRLRVTPGMGERTRCYRCGKEGHWSKECPLDQMTKELEQAPGYPPESFPDPYGPMRSAAAAYRTAYAHRVFYDERERFSIVDYYQRYRVRPSSYDALIERRLTALPSAATTVSYRERIESFPYERHLLPPPPELPSSYYPRERSPLRRSSSASSSMEIYRTERRLSPIMRSPFVDDPRCSRESYYERVQYL
Donor tissue: neurula