ORFeome > rgma – XORFeome 2.0

rgma – XORFeome 2.0

General Information

Species: Xenopus tropicalis RGM domain family, member A, mRNA (cDNA clone MGC:75844 IMAGE:5382608), complete cds
Gene Symbol: rgma
Gene ID: 394653
ORF gb_acc: MG133037
ORF ID: 10432

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061329

Library Location

Plate ID: GDExt11004
Well Location: H07

EST Sequences

Clone: MGC:75844 IMAGE:5382608
Trimmed Sequence: ATGCAGCCGATAAGGGCGAGGGTTGTGGTTAAAGCCCAAGCTGGATGGATGGGTATGGGGAGAGGGGCAGGACCCAAAGCCCTGGGATTCTTCAAAATCCTCACTGTCTTCTTGTGCACGTTTCATACAGTGAGCTCATCGTGCAAGATTTTGAAGTGCACTGCCGACTACTTGCAAGCGACTTCAAACCCACATCATCACGCAGGACCTGAGGACACAGTGGAGATCTGCACCGCACTGCGCACCTACGCCCACTGCAGCCGACGCACGGCACGCACTTGCAGAGGAGACCTTGCTTACCATTCAACTGTCCATGGCATTGATGACCTCATGAGCCACCATAACTGCTCCAAGGATGGCCCCACCTCTCAGCCACGCATACGCATCTTGCCTCCAGGGGACAGCCAAGAGCGCTCCGACAGCCCCGAAATATGCCATTATGAGAAAAGCTTCCACAGACCCTCTGCCCTTCCAAACTATACCCACTGTGGCCTCTTTGGAGACCCACACCTTAGGACGTTTTCAGACACTTTCCAGACCTGCAAAATACAAGGTGCTTGGCCCCTCATAGACAATAATTACTTGAATGTGCAGGTTACCAACACTCCCGTGCTTCCAGGATCAATTGCCACAGCCACCAGCAAGTTGACAATAATTTTCAAGAATTTCCAGGAGTGTGTGGACCAGAAAGTATACCAAGCTGAGATGGATGAGCTTCCTGCAGCTTTTGTTGATGGTTCGAAAAATGGTGGGGACAAGAGCGGAGCCAACAGCTTGAGAATCATTGAGAAAGTGGCAGGGCAGCACATTGAGATCCAGGCCAAGTACATAGGCACCACAATTGTGGTCCGGCAGGTGGGTCGCTACCTGACCTTCGCTGTCCGGATGCCAGAGGAGGTGGTGAATGCTGTGGAGGACAAGGATAACCAGGGACTTTACTTGTGCCTCCACGGTTGCCCTCAAAACCAGCAGATTGACTTTCGAACCTTTCACTCGCAAGCCCCAGAGACTGGTCTCAAGAGGCTAACCAGTGCCGCCTCCAGTGCTGCTTCCTTCACTCCACAGACCGCAGAAGCCAAGTGCAAGGAGAAGCTGCCGGTGGAGGACCTCTACTTCCAGTCTTGCGTTTTTGACCTCCTTACAACAGGGGATGTGAATTTCACACTAGCTGCTTATTATGCCTTTGAGGATGTGAAACTATTACACTCCAACAAGAACAAAGTCCATTTGTTTGAAAGGACCACAGGCTTGGGGCCTTCCAATACAGCCCCCTCAGCAGGAGTGGATGTTCCCCAACTCCTAGTGGCTTTGGTGTGTTTGATTCAGTGCTGTGCAATGTTGCTGTAA
Full Trace Sequence: cgcagcatgagggggaaaggagcactgacccccgtgtgagagctgggctggagctggaagtcctatgggagggtagccccccgggctgggaaggggctcatgcagccgataagggcgagggttgtggttaaagcccaagctggatggatgggtatggggagaggggcaggacccaaagccctgggattcttcaaaatcctcactgtcttcttgtgcacgtttcatacagtgagctcatcgtgcaagattttgaagtgcactgccgactacttgcaagcgacttcaaacccacatcatcacgcaggacctgaggacacagtggagatctgcaccgcactgcgcacctacgcccactgcagccgacgcacggcacgcacttgcagaggagaccttgcttaccattcaactgtccatggcattgatgacctcatgagccaccataactgctccaaggatggccccacctctcagccacgcatacgcatcttgcctccaggggacagccaagagcgctccgacagccccgaaatatgccattatgagaaaagcttccacagaccctctgcccttccaaactatacccactgtggcctctttggagacccacaccttaggacgttttcagacactttccagacctgcaaaatacaaggtgcttggcccctcatagacaataattacttgaatgtgcaggttaccaacactcccgtgcttccaggatcaattgccacagccaccagcaagttgacaataattttcaagaatttccaggagtgtgtggaccagaaagtataccaagctgagatggatgagcttcctgcagcttttgttgatggttcgaaaaatggtggggacaagagcggagccaacagcttgagaatcattgagaaagtggcagggcagcacattgagatccaggccaagtacataggcaccacaattgtggtccggcaggtgggtcgctacctgaccttcgctgtccggatgccagaggaggtggtgaatgctgtggaggacaaggataaccagggactttacttgtgcctccacggttgccctcaaaaccagcagattgactttcgaacctttcactcgcaagccccagagactggtctcaagaggctaaccagtgccgcctccagtgctgcttccttcactccacagaccgcagaagccaagtgcaaggagaagctgccggtggaggacctctacttccagtcttgcgtttttgacctccttacaacaggggatgtgaatttcacactagctgcttattatgcctttgaggatgtgaaactattacactccaacaagaacaaagtccatttgtttgaaaggaccacaggcttggggccttccaatacagccccctcagcaggagtggatgttccccaactcctagtggctttggtgtgtttgattcagtgctgtgcaatgttgctgtaattctatgtttactgtgtaaattcccaactgaataggactatttaaataaaaaaaaaaaaaaaa
Translation: MQPIRARVVVKAQAGWMGMGRGAGPKALGFFKILTVFLCTFHTVSSSCKILKCTADYLQATSNPHHHAGPEDTVEICTALRTYAHCSRRTARTCRGDLAYHSTVHGIDDLMSHHNCSKDGPTSQPRIRILPPGDSQERSDSPEICHYEKSFHRPSALPNYTHCGLFGDPHLRTFSDTFQTCKIQGAWPLIDNNYLNVQVTNTPVLPGSIATATSKLTIIFKNFQECVDQKVYQAEMDELPAAFVDGSKNGGDKSGANSLRIIEKVAGQHIEIQAKYIGTTIVVRQVGRYLTFAVRMPEEVVNAVEDKDNQGLYLCLHGCPQNQQIDFRTFHSQAPETGLKRLTSAASSAASFTPQTAEAKCKEKLPVEDLYFQSCVFDLLTTGDVNFTLAAYYAFEDVKLLHSNKNKVHLFERTTGLGPSNTAPSAGVDVPQLLVALVCLIQCCAMLL
Donor tissue: neurula