ORFeome > rgmb – XORFeome 2.0

rgmb – XORFeome 2.0

General Information

Species: Xenopus tropicalis RGM domain family, member B, mRNA (cDNA clone MGC:75814 IMAGE:5382359), complete cds
Gene Symbol: rgmb
Gene ID: 394547
ORF gb_acc: MG132914
ORF ID: 10280

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061325

Library Location

Plate ID: GDExt11003
Well Location: C12

EST Sequences

Clone: MGC:75814 IMAGE:5382359
Trimmed Sequence: ATGGGCATGGGGAAAAGGGCCGGACTCTCTTACCCCGGGGCTGAGCGGCTGCCCCCGCCTGTCGCAGCCCTGCACCTCCCCGTACTGCTGCTGCTGCTGCTGGCTCTTTGGGGGGACACAGCATATTGCCAACAGCAAACTCAGTGTCGCATCCAAAAGTGCACAACAGACTTTGTTTCTCTTACTTCACATCTGAATACTGGCAGTGACGGTTTCGATTCGGAATTTTGTAAGGCCTTGAGGGCATATGCAGCCTGCACGCAGAGAACTTCCAAAGCATGTCGTGGAAACTTAGTTTACCACTCTGCTGTGTTAGGTATCAGTGACCTCATGAGTCAAAGAAATTGTTCAAAGGATGGTCCCACCTCATCAACAAACCCTGAATTTACTATGGACGCTTGCAACTACCATAACAGGGCGACGGAAAGGATACTACGATCAGGGGATCAAACTCAGCCCAATTATCTGTTCTGTGGCTTGTTTGGAGATCCACATCTGAGAACTTTCCAAGATCATTTTCAGACTTGCAAGGTGGAAGGTGCTTGGCCGCTAATAGACAACAACTATTTGTCAGTGCAAGTGACCAATGTGCCAGTGGTTCCTGGGTCTAGCGCTACTGCAACTAACAAGATAACTATAATATTTAAATCATTTCAAGACTGTACAGACCAGAAAGTGTATCAAGCCGTGACAGACGACCTGCCTGCAGCATTTGTGGATGGCACAACTAGCGGTGGTGATAGTGATTCCAAGTCCTTAAGAATTATAGAGCGAGTTGGGGGAAAGCATGTTGAAATGCATGCCAGATACATTGGCACCACAGTGATTGTGCGCCAGCTTGGAAATTATTTAACCCTAGCAATTCGCATGCCCGAAGAGTTGGCAATGGCATATGAGGAAAGCCAAGACTTACAACTGTGTGTTAATGGATGTCCAACAAGTGAACGTATTGATGAGGGGGGACATCTGCGATTACCTGTAACTGTTAGCAGCACACACGACGGGTCCACTGTTCAAACCGCCTCGCTGTACACACTGGAAAGCGCAAATGAGAAATGTCATGAAAAGATCCAGGTCAAGCACATCTATTTTCACTCCTGTGTTTTTGACTTGCTCACCACTGGGGATGCAAACTTTACAGCAGCTGCTTTCAGTGCTTGGGAGGACGTGGAGACATTACACCCCAGGAAGGAACGCTGGCAAATCTTCCCGAACAAGGCCGGTTGCGCCAACACACACGCTTTGCCTGCTCTTGTGTTTGGCCTTGCAGGCTTGCTGTCGCTTTTTTTGTAG
Full Trace Sequence: caagcctcctgtcccttcctgcatagtccgtgagctgccggcgctacagcgggacatcctgcttcttgtaaccgtgttcccttctctctctctcccgctccctttgtttctcattatgtgtcacatcgttcccatctgacgtcactcgcaccgtcccattatccctgtacgatccctgttccctgtgcatccatgttttcttaaaactttgacgcaatcgttaaggaagaagaggaaaagagccgtccgccttggtacgagcagctgtcaccccggcattgggagcccggcactgccacctgaatggatgggcatggggaaaagggccggactctcttaccccggggctgagcggctgcccccgcctgtcgcagccctgcacctccccgtactgctgctgctgctgctggctctttggggggacacagcatattgccaacagcaaactcagtgtcgcatccaaaagtgcacaacagactttgtttctcttacttcacatctgaatactggcagtgacggtttcgattcggaattttgtaaggccttgagggcatatgcagcctgcacgcagagaacttccaaagcatgtcgtggaaacttagtttaccactctgctgtgttaggtatcagtgacctcatgagtcaaagaaattgttcaaaggatggtcccacctcatcaacaaaccctgaatttactatggacgcttgcaactaccataacagggcgacggaaaggatactacgatcaggggatcaaactcagcccaattatctgttctgtggcttgtttggagatccacatctgagaactttccaagatcattttcagacttgcaaggtggaaggtgcttggccgctaatagacaacaactatttgtcagtgcaagtgaccaatgtgccagtggttcctgggtctagcgctactgcaactaacaagataactataatatttaaatcatttcaagactgtacagaccagaaagtgtatcaagccgtgacagacgacctgcctgcagcatttgtggatggcacaactagcggtggtgatagtgattccaagtccttaagaattatagagcgagttgggggaaagcatgttgaaatgcatgccagatacattggcaccacagtgattgtgcgccagcttggaaattatttaaccctagcaattcgcatgcccgaagagttggcaatggcatatgaggaaagccaagacttacaactgtgtgttaatggatgtccaacaagtgaacgtattgatgaggggggacatctgcgattacctgtaactgttagcagcacacacgacgggtccactgttcaaaccgcctcgctgtacacactggaaagcgcaaatgagaaatgtcatgaaaagatccaggtcaagcacatctattttcactcctgtgtttttgacttgctcaccactggggatgcaaactttacagcagctgctttcagtgcttgggaggacgtggagacattacaccccaggaaggaacgctggcaaatcttcccgaacaaggccggttgcgccaacacacacgctttgcctgctcttgtgtttggccttgcaggcttgctgtcgctttttttgtaggaattttcatgtctttaaacaaaatgtaaaatatatattgttataatatattgagcgaaagataggatcttatatgtatataccgtgtatatgaagggaggtttgtcttgggatacccatgagactgtatatattgtttgtttctatttaccttggatgtagtattactttttttactttttcggtttttgagatgttctatgttcctttattgggacttattagaaagcactttattttttataaaatatttatgtgtgtatacagtttaaaaaaacaaaaaaaaaaaaaaaaa
Translation: MGMGKRAGLSYPGAERLPPPVAALHLPVLLLLLLALWGDTAYCQQQTQCRIQKCTTDFVSLTSHLNTGSDGFDSEFCKALRAYAACTQRTSKACRGNLVYHSAVLGISDLMSQRNCSKDGPTSSTNPEFTMDACNYHNRATERILRSGDQTQPNYLFCGLFGDPHLRTFQDHFQTCKVEGAWPLIDNNYLSVQVTNVPVVPGSSATATNKITIIFKSFQDCTDQKVYQAVTDDLPAAFVDGTTSGGDSDSKSLRIIERVGGKHVEMHARYIGTTVIVRQLGNYLTLAIRMPEELAMAYEESQDLQLCVNGCPTSERIDEGGHLRLPVTVSSTHDGSTVQTASLYTLESANEKCHEKIQVKHIYFHSCVFDLLTTGDANFTAAAFSAWEDVETLHPRKERWQIFPNKAGCANTHALPALVFGLAGLLSLFL
Donor tissue: neurula