ORFeome > rhot2 – XORFeome 2.0

rhot2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ras homolog gene family, member T2, mRNA (cDNA clone MGC:89266 IMAGE:6976815), complete cds
Gene Symbol: rhot2
Gene ID: 448378
ORF gb_acc: MG133814
ORF ID: 11388

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075464

Library Location

Plate ID: GDExt11014
Well Location: H02

EST Sequences

Clone: MGC:89266 IMAGE:6976815
Trimmed Sequence: ATGAAGCGGGACGTGCGGATTCTCCTGCTGGGGGAGGCCCAGGTGGGGAAGACGTCTCTGATTATGGCTCTGGTGGGAGAAGAGTTCCCCGATGAAGTTCCATCTCGTGCGGAAGAAATCACCATTCCTGCTGACGTGACCCCAGAGCGCATCCCGACACACATCGTCGATTACTCAGGTGTAGAACAGACAGAGGATGAACTCAGGGAAGAGATTGCAAAGGCAAACGTTGTGTGCGTTGTATATGATGTTACGGATCTAGAAACCATTGAAAAGATCGGTTCCAAATGGATTCCCATGGTGAATGGCAACGCGGAACGGAACTCCCGGCTTCCCATAATCCTAGTGGGGAACAAATCAGACCTTCAGTGTGGCAGCTCCATGGAATCCATTCTTCCTATCATGAACCAGTTCTCTGAGATTGAGACCTGTGTGGAGTGTTCAGCCAAGAACCTGAAGAACATTTCCGAGGTCTTCTACTATGCTCAGAAGGCAGTCTTGCACCCCACAGCCCCGCTGTACGACCCGGAAGAGAAACAGCTTAGGCCACAGTGCAAAAAGGCCTTAACGCGAATCTTCACCATCTCTGAGCAGGACAACAATCAAATCCTCAGCGACGAAGAGCTGAACTTCTTCCAGCAGTCCTGCTTTGGGAACCCATTAGCTCCTCAAGCTCTGGAAGATGTGAAGATGGTGGTTAAGAAGAACACAGCAGATGGAGTACGAGATAATGGACTGACACTAAACGGCTTCCTGTTCCTCAACACCCTCTTCATCCAGCGAGGCCGCCATGAGACCACGTGGACCATCTTAAGACGTTTTGGATACGACGATGCACTGGAACTGACAGATGACTACCTCTACCCACCGCTGCGCATTCCTCATGAGTCCTCAACGGAACTGAACCACTTCGGCTACCAGTTCTTGCAGAAGGCATTCGAGAAACATGATCTGGATGAAGATGGCGCTCTCAGCCCCTCAGAGCTTCAGAGTTTCTTCAGTGTCTTCCCATACACCCCGTGGGGTCCCGAATTAGCCAGCACCGTATGCACTGCACAAGGGGGCTACCTGCCCCTGCACGGATACCTCTGCCAGTGGACGTTGGTGGCTTATCTGGATGTCCATCGCTGCCTGGAACACCTGGGGTACTTGGGGTACCCTATCCTGTGTGAGCAGGAGAGCCAGACGCACGCCATCACAGTGACGAGGGAGAAGAGCATAGACTTGGAGAAGGGGCAGACGCAGAGAAACGTCTTCCTGTGCAGAGTCATCGGCCCACGTGGGACGGGCAAGTCAGCCTTTCTACGGGCATTTCTGGGGCAGAGTCTAGAGGAGCAACAGCAGAGCAACAAGCCGCCATCGTTCTACTCTGTGAATACAGTGCTGGTCGGCGGCCAAGAGAAGTATCTTATTCTGTTTGAAGTGGACGTGGACACGGAGTTCCTGAAGACGTCTGACGCTCCCTGCGACGTGGCCTGTTTGATGTACGACGTCTCTGACTCCAAATCCTTCAACTACTGTGCCAGCATCTACAAGCAGCACTATATGGAGAGCCAGACCCCGTGCCTGTTTGTCGGCTGTAAGTATGACCAGGGAGAGGTGAAACAGCAGCACGGAATTTCCCCCGCAGAATTCTGTCACAAGCATCGCCTGCCGCCCCCCTACCATTTTACCTGCCAGGGCACCCCCGACAGAACCATCTACAGCAAGCTCGCCACTGCCGCCGCCTTTCCCCATCTACATGACACAGAGCTCAGCACTGCCTCCTTCTGGTTGCGAGTGGCATTGGGCGCTACCGTTGCTGCCGTCGTGGGATTCACCCTGTACAAAGCTCTCCTGCGGAGCAAATAG
Full Trace Sequence: ctggcggtaaaggaagtccccgggcggcaccggagccatgaagcgggacgtgcggattctcctgctgggggaggcccaggtggggaagacgtctctgattatggctctggtgggagaagagttccccgatgaagttccatctcgtgcggaagaaatcaccattcctgctgacgtgaccccagagcgcatcccgacacacatcgtcgattactcaggtgtagaacagacagaggatgaactcagggaagagattgcaaaggcaaacgttgtgtgcgttgtatatgatgttacggatctagaaaccattgaaaagatcggttccaaatggattcccatggtgaatggcaacgcggaacggaactcccggcttcccataatcctagtggggaacaaatcagaccttcagtgtggcagctccatggaatccattcttcctatcatgaaccagttctctgagattgagacctgtgtggagtgttcagccaagaacctgaagaacatttccgaggtcttctactatgctcagaaggcagtcttgcaccccacagccccgctgtacgacccggaagagaaacagcttaggccacagtgcaaaaaggccttaacgcgaatcttcaccatctctgagcaggacaacaatcaaatcctcagcgacgaagagctgaacttcttccagcagtcctgctttgggaacccattagctcctcaagctctggaagatgtgaagatggtggttaagaagaacacagcagatggagtacgagataatggactgacactaaacggcttcctgttcctcaacaccctcttcatccagcgaggccgccatgagaccacgtggaccatcttaagacgttttggatacgacgatgcactggaactgacagatgactacctctacccaccgctgcgcattcctcatgagtcctcaacggaactgaaccacttcggctaccagttcttgcagaaggcattcgagaaacatgatctggatgaagatggcgctctcagcccctcagagcttcagagtttcttcagtgtcttcccatacaccccgtggggtcccgaattagccagcaccgtatgcactgcacaagggggctacctgcccctgcacggatacctctgccagtggacgttggtggcttatctggatgtccatcgctgcctggaacacctggggtacttggggtaccctatcctgtgtgagcaggagagccagacgcacgccatcacagtgacgagggagaagagcatagacttggagaaggggcagacgcagagaaacgtcttcctgtgcagagtcatcggcccacgtgggacgggcaagtcagcctttctacgggcatttctggggcagagtctagaggagcaacagcagagcaacaagccgccatcgttctactctgtgaatacagtgctggtcggcggccaagagaagtatcttattctgtttgaagtggacgtggacacggagttcctgaagacgtctgacgctccctgcgacgtggcctgtttgatgtacgacgtctctgactccaaatccttcaactactgtgccagcatctacaagcagcactatatggagagccagaccccgtgcctgtttgtcggctgtaagtatgaccagggagaggtgaaacagcagcacggaatttcccccgcagaattctgtcacaagcatcgcctgccgcccccctaccattttacctgccagggcacccccgacagaaccatctacagcaagctcgccactgccgccgcctttccccatctacatgacacagagctcagcactgcctccttctggttgcgagtggcattgggcgctaccgttgctgccgtcgtgggattcaccctgtacaaagctctcctgcggagcaaatagcatctccagttattaaccgaccgacacccccccacctctctccttcctgcctcgctaatcactgtgagaggccgaagagcacagaaagcgccatttctgctccctcacaggaacatggttttcttctaaccctatttctttcttactaaaagactaaaaaggggccacagctgtcatctcaaaaagatcctgtaattgctctgcgtcaccgagagactgatggaaaccttcctacagcgatttgtatctgcctcgtccccttctcccagcagagctgccccacatatgaccaaagtgaattaacagcagcggaagtctgtgtgtagatgaggatttttgtatgtttgtcccgactcccactaaaccaacgtttccccaaacctcttgtgtgaaaagaatgcttatcgggttgcccaatcacatcaggccttccatcataaaagtgcaataatatgctgcatgtaaaactccctctcactggccgggctgtgggcagttcctactcagtatatggtgctgctatatcaagagcagataagagggttctgatagaacagcctcccagccttggccgccgcgggggggggggggggggtaaccacttcaatcctctcatcagtgttaacaattccattttatccaacgtatcggctcattgtgatgctgttcgagtctcctggtgccccagcggcccccctagctgacccatctgcatctcgcgctgttgcaggacaccacgttcctgctgttctcctaccagcggcgctacgggcagatgtgcccttgggacccccggagcctccatgatcaatcatgtgcgtttctgtttagcttttgtatcgtcataacgatggactggacaccaggtttttctgtttttatcagatcaatcgcatttctttttttcttttttcgttatttatgaactaaaggaagaaaaagtgcatcggaaaagcaaagggagaccgtgattttacttggtttttacgacagtaaagaataaagacctattttaattaaaaaaaaaaaaaaa
Translation: MKRDVRILLLGEAQVGKTSLIMALVGEEFPDEVPSRAEEITIPADVTPERIPTHIVDYSGVEQTEDELREEIAKANVVCVVYDVTDLETIEKIGSKWIPMVNGNAERNSRLPIILVGNKSDLQCGSSMESILPIMNQFSEIETCVECSAKNLKNISEVFYYAQKAVLHPTAPLYDPEEKQLRPQCKKALTRIFTISEQDNNQILSDEELNFFQQSCFGNPLAPQALEDVKMVVKKNTADGVRDNGLTLNGFLFLNTLFIQRGRHETTWTILRRFGYDDALELTDDYLYPPLRIPHESSTELNHFGYQFLQKAFEKHDLDEDGALSPSELQSFFSVFPYTPWGPELASTVCTAQGGYLPLHGYLCQWTLVAYLDVHRCLEHLGYLGYPILCEQESQTHAITVTREKSIDLEKGQTQRNVFLCRVIGPRGTGKSAFLRAFLGQSLEEQQQSNKPPSFYSVNTVLVGGQEKYLILFEVDVDTEFLKTSDAPCDVACLMYDVSDSKSFNYCASIYKQHYMESQTPCLFVGCKYDQGEVKQQHGISPAEFCHKHRLPPPYHFTCQGTPDRTIYSKLATAAAFPHLHDTELSTASFWLRVALGATVAAVVGFTLYKALLRSK
Donor tissue: tailbud