ORFeome > rnf13 – XORFeome 2.0

rnf13 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ring finger protein 13, mRNA (cDNA clone MGC:79504 IMAGE:6977064), complete cds
Gene Symbol: rnf13
Gene ID: 493377
ORF gb_acc: MG133541
ORF ID: 11070

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080893

Library Location

Plate ID: GDExt11010
Well Location: G09

EST Sequences

Clone: MGC:79504 IMAGE:6977064
Trimmed Sequence: ATGGTGACATTCAGGATGTGCGTTGCCTTGATGAAACCATTTTGCAACCTACTGGCATTCTGTAGCTGTTTAGCTGTTATTCATCTGGTGCCTGTACAAGCAGACGTCGCAGCATATACAGCTGATAATGTGTCTCGGACATTTGATGACCTACCAGCTCGTTTTGGATATAGACTCCCTAGTGATGGATTAAAGGGATACATAGTGACCGCCAAGCCAGAAAATGCTTGTCAGCCAATATCCCCACCACCACTCTTGCGGGACAACACCTCTAGTGTCTTTATTGTACTCATCAAGAGATTGGAATGTAACTTTGACCTGAAGGTGCTGAATGCCCAAAAAGCCGGCTTCAAGGCTGCAGTTGTTTACAATGTGGACTCAGATGACCTTATCAGCATGGGATCTAATGATGTTGATATTTTGAAGCAGATAGACATTCCATCTGTTTTTATTGGGGAGTCTTCAGCACGGTTTTTAAAGGAAGAGTTTTCTTGGGAAAAGGGTGGCTATATTGTGCTAGTCCCTGATCTCACCCTGCCATTGGAATACTACTTGATACCATTCCTCATCATAGTGGGAATCTGCCTTGTGCTAATTGTCATCTTTATGATCACTAAGTTTGTGCAAGATCGGCACAGGGCAAGGAGAAACAGACTTCGTAAAGACCAACTGAAAAAGCTTCCCATACATAAGTTTAAGAAAGGAGATGAGTATGATGTGTGTGCGGTGTGCCTGGATGAATACGAGGAAGGGGATAAGCTGAGAATCCTCCCCTGCTCACATGCCTATCACTGTAAGTGTGTTGACCCATGGCTAACCAAGACAAAGAAGACATGCCCTGTGTGCAAGCAGAAGGTTGTCCCCTCTCAAGGAGATTCAGAGTCAGATTCAGACAGCAGCCAAGAAGACAATGAAGTCTCAGAAAACACCCCACTGCTCCGCCCCATGGCATCTGCCAGCACCCAGTCTTTTGGGGCTATCTCTGAATCTCACTCACAACAAAACATGATGGAGTCTTCCGGCGAAGATGAGGATGATGACGATGATGAAGATGACTCTGACAGCAGCGATGAGGAGCACAACACAGAAAGTGTTGTAGTTCAGTTGCAGCACAACATGGAGAGGGAGTCCAGGGAAAGGAATACTGTGTGA
Full Trace Sequence: ggagagatgaagaggcctgaatctgcggctgtggcaagtgaataggaaactgctgtagcagcaactagagctcttttcagggttcggaaggaaagagggagcttctcagggctctgactatccaagcaagctctttccgggaatgggaaaccaaagggagttctttcttgtactctgaacatactgcaacttaagtggggatttcccagcacatagcaagcgggacccattccgagtgaggctctcccggctggcacacgtgtttagtgctactggcataatggtgacattcaggatgtgcgttgccttgatgaaaccattttgcaacctactggcattctgtagctgtttagctgttattcatctggtgcctgtacaagcagacgtcgcagcatatacagctgataatgtgtctcggacatttgatgacctaccagctcgttttggatatagactccctagtgatggattaaagggatacatagtgaccgccaagccagaaaatgcttgtcagccaatatccccaccaccactcttgcgggacaacacctctagtgtctttattgtactcatcaagagattggaatgtaactttgacctgaaggtgctgaatgcccaaaaagccggcttcaaggctgcagttgtttacaatgtggactcagatgaccttatcagcatgggatctaatgatgttgatattttgaagcagatagacattccatctgtttttattggggagtcttcagcacggtttttaaaggaagagttttcttgggaaaagggtggctatattgtgctagtccctgatctcaccctgccattggaatactacttgataccattcctcatcatagtgggaatctgccttgtgctaattgtcatctttatgatcactaagtttgtgcaagatcggcacagggcaaggagaaacagacttcgtaaagaccaactgaaaaagcttcccatacataagtttaagaaaggagatgagtatgatgtgtgtgcggtgtgcctggatgaatacgaggaaggggataagctgagaatcctcccctgctcacatgcctatcactgtaagtgtgttgacccatggctaaccaagacaaagaagacatgccctgtgtgcaagcagaaggttgtcccctctcaaggagattcagagtcagattcagacagcagccaagaagacaatgaagtctcagaaaacaccccactgctccgccccatggcatctgccagcacccagtcttttggggctatctctgaatctcactcacaacaaaacatgatggagtcttccggcgaagatgaggatgatgacgatgatgaagatgactctgacagcagcgatgaggagcacaacacagaaagtgttgtagttcagttgcagcacaacatggagagggagtccagggaaaggaatactgtgtgatcaagccacgcactggcagcattactacatgaatatgtcagtaaacaaaagccgttgccatttgcttatctcagttagaagccatttatgactttagagaaataacacatttattttcagaaaaatcctcaactttcttataatggctgtctgctccataatattcccttttatctctgatgcgacactgcttcttatacaattagtatatcgattgtttgaatggagctgctgaatagcaagtcaatcagccctgtatttttttagacactacactaacccagggcaataagaaccagcaacacctgcatggtactctgagatcccaaactcctggtgcagtcaggacttgcacattggccttggggctgacatggctggaacaataacgaaggccttgtatgacttttactataggttgtgtaaatgagattgaggacatgtcctggtgacatagaagccacaagagccccaatggtgagtgatacgggcaagaagaggccacacgcaaatagatgatataataacaatacaaacatctttttcatagaaaaaaaaaaccttacttgacattgttgattatttatgattcagtatagttatccgtacggaatgaactggagaaaatctaagacgtgaacaaacggaagtgttatgttcatactatataaaaacctctctggtagagaatatatatgggatttttttttttctgttttctcatttgtacagtttctctgcattcatgcactataggaataaagcttatacacttatcctgttattcaagcgcaagcttactttaccgatgtagaaaggcacaatgtatgtacagttcacctgttttatatcactgagagtgaaatctaaaaataaaatgtggtttcacacttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVTFRMCVALMKPFCNLLAFCSCLAVIHLVPVQADVAAYTADNVSRTFDDLPARFGYRLPSDGLKGYIVTAKPENACQPISPPPLLRDNTSSVFIVLIKRLECNFDLKVLNAQKAGFKAAVVYNVDSDDLISMGSNDVDILKQIDIPSVFIGESSARFLKEEFSWEKGGYIVLVPDLTLPLEYYLIPFLIIVGICLVLIVIFMITKFVQDRHRARRNRLRKDQLKKLPIHKFKKGDEYDVCAVCLDEYEEGDKLRILPCSHAYHCKCVDPWLTKTKKTCPVCKQKVVPSQGDSESDSDSSQEDNEVSENTPLLRPMASASTQSFGAISESHSQQNMMESSGEDEDDDDDEDDSDSSDEEHNTESVVVQLQHNMERESRERNTV
Donor tissue: tailbud