ORFeome > rnf139 – XORFeome 2.0

rnf139 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ring finger protein 139, mRNA (cDNA clone MGC:69352 IMAGE:5309221), complete cds
Gene Symbol: rnf139
Gene ID: 407923
ORF gb_acc: MG133269
ORF ID: 10753

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067995

Library Location

Plate ID: GDExt11007
Well Location: E06

EST Sequences

Clone: MGC:69352 IMAGE:5309221
Trimmed Sequence: ATGGAGTCCCCTCCGGTGGTGGTCGGGCAGCGGGTACGGGCCGTGCTGGATGTGGCCTTGCGGGTTCCCTCTCTCTTTATCACGGACGCCATCCTGAACTTGCCCCACGATGCCTCTGCCGGCTTCCTGTCACTGCTGCTGCAGCTGGCGCTCAGACTGCTGGGTGTTGTGGCATCCATTGTTGTGCTGGTGTTGTCTCGCAGAGCACTTTTCAAGTTCTACATGATCACGGCGGCCCTAGCGCTGGCTGCAACTTCAGTGTTGGTCAGTTACTATGCCACCTTGCACTTGAACTTTTCCCGTGCCTCCTACTCCGCGGCTTTGGGGCTTGAATTTCTTCCTTCCAACGGACCTTCCCTATGGATGACGCTTATTGTATTACAACTTATTTTTGGCATTGGTTTCATCACGTTACTCCAGGTCCAGTCCTACTCCCAGCTAATAATACTTGACCTGCTGATCCCCACAGTTGGCTTTATAATAGAACTTCCACTCGGCGTGCAACAAATTTTGGTTTTCATTTCTGCCCTCGTTCTCATACTCTACACTGTAGCTTGCTTGGCTTTCCGCTTCAGATGGTTCTACTACTCAACGAAATATACCGTGCTCCTCCTCAAGCACATGTACCAAGTGTATGGAATACAGCTCATGGTTGAGGATGCTTGGAAAAAGATTCACTTCCCAGACGTGCTGCGCGTTTTCTGGCTGACGCGCTTAGCGACCCAAGCCGTGTTCTTATTCTACGTGGTCAGAGAGTCGAGCAGCGACGCGGGAGAGGTTTCTTACTTTATACCTTGGAATGACCTTTCGGAACTTGTGTGCAACCTAATTATCAATGGCTGCGATTCCACCCTAACAGTATTGGGAATGAGCGCGGTGATCTCGTCAATTGCCCATTACTTGGGCCTGGGAATTCTAGCCTTCATCGGGTCGACGGAGGAAGAGGATAAGCGGCTCGGCTTTGTGGCACCAGTGCTGTTCTTCATATTGGCTCTCCAAACTGGACTGAGTGGGTTGAAACCGGAGGAACGACTTGTCCGCCTTTGTCGAAACATGTGCCTTTTGTTAACAGCAGTCTTGCATTTCATCCACGGAATGACTGACCCCGTGCTAATGTCACTTAGTGCCTCCCATGTGTCATCGTACCGCAGGCACCTTCCAGTATTGCTGGTTTCTGTTTGCCTTTTTGTTCTTCCAGTTCTGCTCAGTTGTGTGCTGTGGCACTACTATGCACTTAACACATGGCTGTTTGCCGTCACGGCATTCTGCGTAGAGCTTTGCTTGAAAGTCATTGTTTCTCTGACAGTCTACACACTGTTTATGATTGACGGTTACTACAGCGTGCTGTGGGAAAAGCTCGACGACTACGTCTACTACGTGCGCTCAACTGGTAGTATTATCGAATTCATCTTCGGAGTAATCATGTTCGGAAATGGGGCCTACACGATGATGTTTGAATCTGGCAGCAAGATCCGGGCATGCATGATGTGTCTGCACGCTTACTTCAACATCTACCTGCAAGCCAAGAACGGGTGGAAGACCTTCATGAACCGGAGGAAAGCTGTGAAAAAAATAAACTCGCTTCCAGAAGTCAAGGGTTCGGAATCACGAGAGATAGACGACGTGTGTGCGATCTGCTACCAAGAGTTCCACACCTCTGCCCGTATTACCCCATGCCACCATTACTTTCATGCCCTTTGCCTTCGCAAGTGGTTGTACATACAAGACACTTGTCCTATGTGCCATCAGAAAGTATATATCGACGATGATTCAAAAGAGAACGCCTCTGTATCCAACAATAATGGTTTTGTGGCGCCCAACGAGGAACCCGCGCAACCCGACGCTGATCGGGAGGCGGATCAGGAACTCGAGGAGCAAAACCTCAGCGAAGACGACAGCGTGGAGTGCGACGACGAGGAATGGACGACAGAACCGCACAACTCCACTTCTGAGGAACACGTCAGCGACGATACAGACTCTCTTGGGGAATAA
Full Trace Sequence: cgcggaaggagatgagggggcaattggattccggagggaaatagcccgagggggcggcggagcccatggagtcccctccggtggtggtcgggcagcgggtacgggccgtgctggatgtggccttgcgggttccctctctctttatcacggacgccatcctgaacttgccccacgatgcctctgccggcttcctgtcactgctgctgcagctggcgctcagactgctgggtgttgtggcatccattgttgtgctggtgttgtctcgcagagcacttttcaagttctacatgatcacggcggccctagcgctggctgcaacttcagtgttggtcagttactatgccaccttgcacttgaacttttcccgtgcctcctactccgcggctttggggcttgaatttcttccttccaacggaccttccctatggatgacgcttattgtattacaacttatttttggcattggtttcatcacgttactccaggtccagtcctactcccagctaataatacttgacctgctgatccccacagttggctttataatagaacttccactcggcgtgcaacaaattttggttttcatttctgccctcgttctcatactctacactgtagcttgcttggctttccgcttcagatggttctactactcaacgaaatataccgtgctcctcctcaagcacatgtaccaagtgtatggaatacagctcatggttgaggatgcttggaaaaagattcacttcccagacgtgctgcgcgttttctggctgacgcgcttagcgacccaagccgtgttcttattctacgtggtcagagagtcgagcagcgacgcgggagaggtttcttactttataccttggaatgacctttcggaacttgtgtgcaacctaattatcaatggctgcgattccaccctaacagtattgggaatgagcgcggtgatctcgtcaattgcccattacttgggcctgggaattctagccttcatcgggtcgacggaggaagaggataagcggctcggctttgtggcaccagtgctgttcttcatattggctctccaaactggactgagtgggttgaaaccggaggaacgacttgtccgcctttgtcgaaacatgtgccttttgttaacagcagtcttgcatttcatccacggaatgactgaccccgtgctaatgtcacttagtgcctcccatgtgtcatcgtaccgcaggcaccttccagtattgctggtttctgtttgcctttttgttcttccagttctgctcagttgtgtgctgtggcactactatgcacttaacacatggctgtttgccgtcacggcattctgcgtagagctttgcttgaaagtcattgtttctctgacagtctacacactgtttatgattgacggttactacagcgtgctgtgggaaaagctcgacgactacgtctactacgtgcgctcaactggtagtattatcgaattcatcttcggagtaatcatgttcggaaatggggcctacacgatgatgtttgaatctggcagcaagatccgggcatgcatgatgtgtctgcacgcttacttcaacatctacctgcaagccaagaacgggtggaagaccttcatgaaccggaggaaagctgtgaaaaaaataaactcgcttccagaagtcaagggttcggaatcacgagagatagacgacgtgtgtgcgatctgctaccaagagttccacacctctgcccgtattaccccatgccaccattactttcatgccctttgccttcgcaagtggttgtacatacaagacacttgtcctatgtgccatcagaaagtatatatcgacgatgattcaaaagagaacgcctctgtatccaacaataatggttttgtggcgcccaacgaggaacccgcgcaacccgacgctgatcgggaggcggatcaggaactcgaggagcaaaacctcagcgaagacgacagcgtggagtgcgacgacgaggaatggacgacagaaccgcacaactccacttctgaggaacacgtcagcgacgatacagactctcttggggaataagcattatttaattgcgttttttttgcctttgtgtgtctaaatcattaaggtgtttgaaatccagatcagagaatttttttctttttttttttttctacatccgaaagcacaaaatcagaatctcgaggccaggtctggatggatagttcttgttaagtgctactgtaaatattccttttggtctctgttgtgacctaattaaatgtgtacattcttgtacatggaataaaactttgaatttgcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MESPPVVVGQRVRAVLDVALRVPSLFITDAILNLPHDASAGFLSLLLQLALRLLGVVASIVVLVLSRRALFKFYMITAALALAATSVLVSYYATLHLNFSRASYSAALGLEFLPSNGPSLWMTLIVLQLIFGIGFITLLQVQSYSQLIILDLLIPTVGFIIELPLGVQQILVFISALVLILYTVACLAFRFRWFYYSTKYTVLLLKHMYQVYGIQLMVEDAWKKIHFPDVLRVFWLTRLATQAVFLFYVVRESSSDAGEVSYFIPWNDLSELVCNLIINGCDSTLTVLGMSAVISSIAHYLGLGILAFIGSTEEEDKRLGFVAPVLFFILALQTGLSGLKPEERLVRLCRNMCLLLTAVLHFIHGMTDPVLMSLSASHVSSYRRHLPVLLVSVCLFVLPVLLSCVLWHYYALNTWLFAVTAFCVELCLKVIVSLTVYTLFMIDGYYSVLWEKLDDYVYYVRSTGSIIEFIFGVIMFGNGAYTMMFESGSKIRACMMCLHAYFNIYLQAKNGWKTFMNRRKAVKKINSLPEVKGSESREIDDVCAICYQEFHTSARITPCHHYFHALCLRKWLYIQDTCPMCHQKVYIDDDSKENASVSNNNGFVAPNEEPAQPDADREADQELEEQNLSEDDSVECDDEEWTTEPHNSTSEEHVSDDTDSLGE
Donor tissue: gastrula