ORFeome > rrm2 – XORFeome 2.0

rrm2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ribonucleotide reductase M2 polypeptide, mRNA (cDNA clone MGC:75900 IMAGE:5383468), complete cds
Gene Symbol: rrm2
Gene ID: 394645
ORF gb_acc: MG133021
ORF ID: 10410

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061353

Library Location

Plate ID: GDExt11004
Well Location: E09

EST Sequences

Clone: MGC:75900 IMAGE:5383468
Trimmed Sequence: ATGCTGTCTCCGCGCAATGCGCTCAGTCCTCTTAAGGATAATGTGTCCCCCATGAAGAGGATGGCGCTGCTGGATAAAGAGAACACGCCCCCCGGCTTCAACTCGGGCAGGACCTCCCGGGGAACACACAAACAATGGGTTTGTCAAAGCTTAAAAGATCCTAGAATACAGGATGAGCCTCTCCTCAGGGATAACCCAGGGCGCTTTGTGATCCTACCTATTGAGTATCATGATATTTGGCAGATGTACAAGAAGGCGGAGGCTTCTTTCTGGACAGCAGAAGAGGTGGATCTTTCTAAAGATCTTCCGCACTGGGAAGCTCTAAAGCCTGAGGAAAGATACTTCATTTCTTATGTGTTGGCCTTTTTTGCAGCAAGTGATGGCATTGTGAATGAGAATCTGGTGGAGCGCTTCAGCCAGGAAGTGCAAGTAACAGAGGCTCGCTGCTTTTATGGCTTCCAAATTGCAATGGAGAATATTCATTCTGAGATGTACAGCCTTCTTATCGACACCTACATTAAAGATCCCAAGGAAAGGGAGTTCCTCTTCAATGCAATAGAAACCTTACCCTGTGTGAAAAAGAAGGCAGAATGGGCCCTGCGTTGGATAAGCGACAGAGAAGCACCTTTTTGCGAGCGCATTGTGGCCTTTGCTGCTGTTGAAGGGATCTTTTTCTCCGGTTCATTTGCTTCCATATTCTGGCTGAAGAAACGGGGGCTGATGCCTGGACTCACTTTCTCTAATGAACTTATCAGCAGAGATGAAGGTTTACACACTGACTTTGCTTGCCTTCTGTTTAAACATGTCGTACACAAACCCTCTGAGCAGCGTGTCAGGGAAATTATCATTGATGCTGTCAAGATTGAGCAGGAGTTCTTGACTGAAGCTTTGCCCGTGGAGCTAATTGGTATGAACTGCAAACTGATGAAGCAGTATATTGAATTTGTGGCAGATCGTCTTCTGCTGGAGCTAGGTTTTAAAAAGATTTTTAAGAGTGAGAATCCATTTGATTTTATGGAGAACATATCCTTGGAAGGAAAGACTAATTTCTTTGAGAAGAAAGTTGCCGAATACCAGAAGATGGGTGTCATGTCCAAGGCAACAGACAAGCAATTCACTTTAAATGCCGAATTTTAA
Full Trace Sequence: ggttctccctcgactacctataaattgcagatgcccctcagtgtcggtcagtccggccggttctctagcagttgaggtactataggttgaagggaaaacaacatgctgtctccgcgcaatgcgctcagtcctcttaaggataatgtgtcccccatgaagaggatggcgctgctggataaagagaacacgccccccggcttcaactcgggcaggacctcccggggaacacacaaacaatgggtttgtcaaagcttaaaagatcctagaatacaggatgagcctctcctcagggataacccagggcgctttgtgatcctacctattgagtatcatgatatttggcagatgtacaagaaggcggaggcttctttctggacagcagaagaggtggatctttctaaagatcttccgcactgggaagctctaaagcctgaggaaagatacttcatttcttatgtgttggccttttttgcagcaagtgatggcattgtgaatgagaatctggtggagcgcttcagccaggaagtgcaagtaacagaggctcgctgcttttatggcttccaaattgcaatggagaatattcattctgagatgtacagccttcttatcgacacctacattaaagatcccaaggaaagggagttcctcttcaatgcaatagaaaccttaccctgtgtgaaaaagaaggcagaatgggccctgcgttggataagcgacagagaagcacctttttgcgagcgcattgtggcctttgctgctgttgaagggatctttttctccggttcatttgcttccatattctggctgaagaaacgggggctgatgcctggactcactttctctaatgaacttatcagcagagatgaaggtttacacactgactttgcttgccttctgtttaaacatgtcgtacacaaaccctctgagcagcgtgtcagggaaattatcattgatgctgtcaagattgagcaggagttcttgactgaagctttgcccgtggagctaattggtatgaactgcaaactgatgaagcagtatattgaatttgtggcagatcgtcttctgctggagctaggttttaaaaagatttttaagagtgagaatccatttgattttatggagaacatatccttggaaggaaagactaatttctttgagaagaaagttgccgaataccagaagatgggtgtcatgtccaaggcaacagacaagcaattcactttaaatgccgaattttaaatgtttcttatatttgtgtttaaatgtgcatggcatttataaatgccgccagttttttactctgttctagtctgcatgctatagtaaagtatgtgtgccttcactttgaaaacaaatgttgcttgttcttggtcctgcttataaagagagcaggtaagtcagtgtcagaaaatctaccttgctctgtggtgcctccacagaatactctatagcttggtatgagcaggaacaccttttgtagttttgatagatctttgattataaaatgttgtaataaaaatgtaatatataattgaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLSPRNALSPLKDNVSPMKRMALLDKENTPPGFNSGRTSRGTHKQWVCQSLKDPRIQDEPLLRDNPGRFVILPIEYHDIWQMYKKAEASFWTAEEVDLSKDLPHWEALKPEERYFISYVLAFFAASDGIVNENLVERFSQEVQVTEARCFYGFQIAMENIHSEMYSLLIDTYIKDPKEREFLFNAIETLPCVKKKAEWALRWISDREAPFCERIVAFAAVEGIFFSGSFASIFWLKKRGLMPGLTFSNELISRDEGLHTDFACLLFKHVVHKPSEQRVREIIIDAVKIEQEFLTEALPVELIGMNCKLMKQYIEFVADRLLLELGFKKIFKSENPFDFMENISLEGKTNFFEKKVAEYQKMGVMSKATDKQFTLNAEF
Donor tissue: neurula