ORFeome > sirt6 – XORFeome 2.0

sirt6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis sirtuin (silent mating type information regulation 2 homolog) 6, mRNA (cDNA clone MGC:76070 IMAGE:5307681), complete cds
Gene Symbol: sirt6
Gene ID: 394980
ORF gb_acc: MG132732
ORF ID: 10031

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064193

Library Location

Plate ID: GDExt11001
Well Location: G10

EST Sequences

Clone: MGC:76070 IMAGE:5307681
Trimmed Sequence: ATGTCGGTGAATTATGCGGCTGGCCTGTCTCCCTATTCCGATAAGGGACGATGTGGGCTCCCGGAGGCATTTGATCCACCGGACGAACTGTGTCGCAAGGTAGTGGAACTAGCTGATATGATTCGGAAATCCTCCTACGTAGTATTTCACACGGGAGCCGGGATCAGTACTTCCTGCGGAATCCCAGATTTCAGGGGGCCTAATGGAGTGTGGACTCTGGAGGAGAAAGGTGTGAACCCAAAGTTTGACATCACGTTTGAATCTGCATGTCCTTCCCCTACCCACATGGCGCTGCTTCAGCTGCAGAGGGTTGGCATCCTGAAATTTTTGGTTAGCCAAAACGTAGATGGCTTGCATGTAAGATCTGGCTTCCCCAGAGAGCAGCTGGCAGAACTACATGGAAACATGTTCGTGGAGGAATGCAGCAAATGTAGCAAACAGTACGTGCGAGATCAAGTTGTAGGAACCATGGGGCTCAAACCTACTGGGAGACTCTGTGATGTGCCCAAGGTGCGAGGCCTGAGAGCTTGCAGGGGGAAGCTCAAAGACACCATTTTGGATTGGGAAGACTCACTTCCTGACAGAGACCTAAACCTAGCCGATGAAGCCTGCAGGAAAGCAGACCTGTCCATTACATTGGGGACATCACTGCAGATTAGACCCAGTGGGAACCTACCACTCCTCACCAAGCGCAAGGGTGGGAAACTAGTTATTGTAAACCTTCAGCCGACCAAGCATGACAAGCACGCGGATTTGAGAATACACGGTTATGTGGATGAAGTGATGACACAGCTCATGGAGCTTTTGGGTCACAAGATACCAGTTTGGACTGGTATGCCTACTAAAACAGAGCCAACTAATGGAAACTATAAGGAGGAAAATCATTTCTACAATGATTCAGTGCTGGGTGCTAACCCAAACCAAAAAAGAGAAGGATGCAAGGAAGAACCTAATCTCGAGCCAAAAAAGGCAAAAGTTGAGCCAGCATGTGTATGA
Full Trace Sequence: ggcgacatgtcggtgaattatgcggctggcctgtctccctattccgataagggacgatgtgggctcccggaggcatttgatccaccggacgaactgtgtcgcaaggtagtggaactagctgatatgattcggaaatcctcctacgtagtatttcacacgggagccgggatcagtacttcctgcggaatcccagatttcagggggcctaatggagtgtggactctggaggagaaaggtgtgaacccaaagtttgacatcacgtttgaatctgcatgtccttcccctacccacatggcgctgcttcagctgcagagggttggcatcctgaaatttttggttagccaaaacgtagatggcttgcatgtaagatctggcttccccagagagcagctggcagaactacatggaaacatgttcgtggaggaatgcagcaaatgtagcaaacagtacgtgcgagatcaagttgtaggaaccatggggctcaaacctactgggagactctgtgatgtgcccaaggtgcgaggcctgagagcttgcagggggaagctcaaagacaccattttggattgggaagactcacttcctgacagagacctaaacctagccgatgaagcctgcaggaaagcagacctgtccattacattggggacatcactgcagattagacccagtgggaacctaccactcctcaccaagcgcaagggtgggaaactagttattgtaaaccttcagccgaccaagcatgacaagcacgcggatttgagaatacacggttatgtggatgaagtgatgacacagctcatggagcttttgggtcacaagataccagtttggactggtatgcctactaaaacagagccaactaatggaaactataaggaggaaaatcatttctacaatgattcagtgctgggtgctaacccaaaccaaaaaagagaaggatgcaaggaagaacctaatctcgagccaaaaaaggcaaaagttgagccagcatgtgtatgatactggtcttcttagttcaaaaaaggtgctatattccttaacttggctctaactttgttttgtgctggacataagaatacccatatttggatatgtatgagccaaactattttatataatgttacacacagtgctgtattagcttgtacatgtcttcttgactgagacaggcacacacattagagaaaatgtatccgtgagagatgtgccactcagtttcactaaagttttctttttcaggatgtatatctagcaatgcatataaaaagacttgatattgtacattcctctattttaaaaaaagggaaaaaaaaacaaaaaacagtttacagaactgccagccatttctttaaacagaaataaaatacaactttctcagatgaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSVNYAAGLSPYSDKGRCGLPEAFDPPDELCRKVVELADMIRKSSYVVFHTGAGISTSCGIPDFRGPNGVWTLEEKGVNPKFDITFESACPSPTHMALLQLQRVGILKFLVSQNVDGLHVRSGFPREQLAELHGNMFVEECSKCSKQYVRDQVVGTMGLKPTGRLCDVPKVRGLRACRGKLKDTILDWEDSLPDRDLNLADEACRKADLSITLGTSLQIRPSGNLPLLTKRKGGKLVIVNLQPTKHDKHADLRIHGYVDEVMTQLMELLGHKIPVWTGMPTKTEPTNGNYKEENHFYNDSVLGANPNQKREGCKEEPNLEPKKAKVEPACV
Donor tissue: gastrula