ORFeome > six6 – XORFeome 2.0

six6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SIX homeobox 6, mRNA (cDNA clone MGC:122113 IMAGE:7623919), complete cds
Gene Symbol: six6
Gene ID: 100101705
ORF gb_acc: MG136361
ORF ID: 14765

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC135852

Library Location

Plate ID: GDExt11045
Well Location: E01

EST Sequences

Clone: MGC:122113 IMAGE:7623919
Full Trace Sequence: gcgagtgcagccagagatcatcttcaagtaggtcgagctcacatcttgtcatctttttatgcggagtcgacgttcgaaaagctgatttggcaacaaaatcagagtcaatgtttcagctgcctattctgaacttcagcccccagcaggtagctggggtgtgtgagaccctagaagagagtggggacattgagcgccttggtcgctttctgtggtcattgccagtagctcctgcagcctgtgaggcacttaataaaaatgagtctgtcctccgagctagggctattgtggcctttcatacggggaacttcagggaactctaccacattctggaaaatcacaaatttaccaaggactcgtacaccaagctgcaggctctgtggctggaggcgcattaccaagaagcagagaagctaagggggagacctttggggccagtagataagtacagagtgagaaagaagttccctctccccagaactatttgggacggggaacagaagactcactgctttaaagaacgaacgaggcatttgcttagggaatggtacctacaagatccctatccaaatcccagcaaaaaaagggaactcgcccaagcgactggacttaccccaacacaagtagggaactggttcaaaaaccggagacaaagagacagagcagcggcggctaagaacaggctgcagcagcaagtcttgtcccagggaactggccattcattgggtccggatgagagaggagaaccgctgggctcagcctccagtcctgcagcaagtctgtccagcaaagcggccacctctgccatctccatcacatccagcgacagtgaatgtgacatctgacccatgggcacacttagcgcagcacaaactcacaacacagtgcctgactaagcgttacagcctgggccacaggaccattaacaggccgtctcagtaccagggttcgcttatcacattggcatttctgactactgatctgcctgcaattcacaatagaagactgtaaggtttgtcacacttaatctggggacctactaatccaatgcctcgattgcctactctccaagtgtctga
Donor tissue: embryo