ORFeome > skap1 – XORFeome 2.0

skap1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis src kinase associated phosphoprotein 1, mRNA (cDNA clone MGC:89494 IMAGE:6992227), complete cds
Gene Symbol: skap1
Gene ID: 448448
ORF gb_acc: MG133999
ORF ID: 11599

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075553

Library Location

Plate ID: GDExt11015
Well Location: B09

EST Sequences

Clone: MGC:89494 IMAGE:6992227
Trimmed Sequence: ATGCAGGGCTACGACATCCCGCGAGATGTGATCAGTCTGCTGAAAGATGCAGAGACTTACTTAGCTGAGTGCTTGCAGAATGAAAAGCTGAGCGGCAGGGCAAGAGAGCAAAGGGATGAGATCCTGCACAGCTTCGGGCAAATCCGAAACAGGTACGGAGTAGAATTTGCACTGAAAGGAGGTGAGGCTGCCTTTACCCATACGGGACAGGATGATTACGATGACATTCACAACGCAAGTTATGCTCCATCTCAAGCCTCTGATGAGGTCTCTGTTGCTTCTGATTATGTGGAAAATGACTCTGAAGTTGAAGAAGAACTGGATAAAATCTTTAAACAGGGCTATCTCGAGAGGAGAAAGAAAGATCATGGCTTTTTTGGATCGGAGTGGCAGAAGAGGTGGTGTGTGCTCACAACGAGAGCCTTCCTATATTATTCTAGTGAGAAAGGGAAGCAGCCCAAAAATGGTTTCCTCATTAAAGATTCTCTAGCACAAATGATGCCTTACATTCGCAAAGACTCCCGGCGTGACAGTTGTTTTGAAGTTGTGACACCAAACCAACAGGTTTTCCAGTTTACTGCTGCCAGCCCATCCGATGCCAGAGACTGGGTGGAACAAATACAGTTCTTGGTGAAAGACACACAGTCGACCATTATTCCCTATGAGGATGATGAGGAAACCTATGACGACATTGAAAGCACCGAGTCCTCTCCAGTAGTTGGGCTAACAAATGATTCGGAAAACAGCCTGCAGGAAGACGATGTCTATGAATCGATACCAGGGGATGAAGAAACAGAGGAATCCGAAGATGAAAATTATGAGATGAAACCAGGCGAACCTGTGATCTTCTATGGAGATTATTACCAAGGACTTTGGAACTGTTTTAGTGACAATAGTGATGAGCTGTCCTTTGAGCGAGGCGACCTTATCCACATCCTGAGCAAGGAGTACCATGCGTACGGCTGGTGGGTCGGAGAGCTGGATGGCATTGTGGGCATTGTGCCAAAGGACTATCTGACGCTTGCCTTCGACCTATAA
Full Trace Sequence: tcaggctcaacctgtctgccctacaacctgctctatttgaatatctgcagatttcccgcccagtggagttcaggtgactgctttattcgccctctgcctgggattatatgagggcttgactggccactgagcagcgtcgcgacatgcagggctacgacatcccgcgagatgtgatcagtctgctgaaagatgcagagacttacttagctgagtgcttgcagaatgaaaagctgagcggcagggcaagagagcaaagggatgagatcctgcacagcttcgggcaaatccgaaacaggtacggagtagaatttgcactgaaaggaggtgaggctgcctttacccatacgggacaggatgattacgatgacattcacaacgcaagttatgctccatctcaagcctctgatgaggtctctgttgcttctgattatgtggaaaatgactctgaagttgaagaagaactggataaaatctttaaacagggctatctcgagaggagaaagaaagatcatggcttttttggatcggagtggcagaagaggtggtgtgtgctcacaacgagagccttcctatattattctagtgagaaagggaagcagcccaaaaatggtttcctcattaaagattctctagcacaaatgatgccttacattcgcaaagactcccggcgtgacagttgttttgaagttgtgacaccaaaccaacaggttttccagtttactgctgccagcccatccgatgccagagactgggtggaacaaatacagttcttggtgaaagacacacagtcgaccattattccctatgaggatgatgaggaaacctatgacgacattgaaagcaccgagtcctctccagtagttgggctaacaaatgattcggaaaacagcctgcaggaagacgatgtctatgaatcgataccaggggatgaagaaacagaggaatccgaagatgaaaattatgagatgaaaccaggcgaacctgtgatcttctatggagattattaccaaggactttggaactgttttagtgacaatagtgatgagctgtcctttgagcgaggcgaccttatccacatcctgagcaaggagtaccatgcgtacggctggtgggtcggagagctggatggcattgtgggcattgtgccaaaggactatctgacgcttgccttcgacctataaacaacacaaacctgccagcccacaagatggctgatggagaagcaaatcactctcatgcatgtacttgtagctttaaattaccaataaatactcctatattaaaaaaaaaaaaaaaaa
Translation: MQGYDIPRDVISLLKDAETYLAECLQNEKLSGRAREQRDEILHSFGQIRNRYGVEFALKGGEAAFTHTGQDDYDDIHNASYAPSQASDEVSVASDYVENDSEVEEELDKIFKQGYLERRKKDHGFFGSEWQKRWCVLTTRAFLYYSSEKGKQPKNGFLIKDSLAQMMPYIRKDSRRDSCFEVVTPNQQVFQFTAASPSDARDWVEQIQFLVKDTQSTIIPYEDDEETYDDIESTESSPVVGLTNDSENSLQEDDVYESIPGDEETEESEDENYEMKPGEPVIFYGDYYQGLWNCFSDNSDELSFERGDLIHILSKEYHAYGWWVGELDGIVGIVPKDYLTLAFDL
Donor tissue: neurula