ORFeome > slc13a4 – XORFeome 2.0

slc13a4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis slc13a4 protein, mRNA (cDNA clone MGC:97522 IMAGE:5382301), complete cds
Gene Symbol: slc13a4
Gene ID: 595063
ORF gb_acc:
ORF ID: 12081

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC093452

Library Location

Plate ID: GDExt11020
Well Location: E05

EST Sequences

Clone: MGC:97522 IMAGE:5382301
Trimmed Sequence: ATGTCATTTCTCCGCCAGCTCTGGCAGCAGAAGGATGTGCTCATTACTTTCCTGCTGCCTCTTCTCTTCCTGCCCCTGCCCCTGGCAACTCAGAGCAAGGAAGCAGCATGTGCTTACATCTTATTGGTCACTGCCGTTTACTGGATATCAGAGGCCATCCCACTCGGTGCCGCCGCTTTGGTTCCTGCCTTCTTATTCCCACTCTTTGGCATCATGAAATCAAGTGAGGTGGCATCTGAATACTTTAAAGACATTCATCTCCTCTTATTCGGCGTTGTGTGTTTGGCCGCCTCCATCCAGAAGTGGAACCTGCACAAACGGATAGCGCTTTGGATGGTCCTGTCTGTTGGAAGCAAGCCCAGCTGGCTTCTTTTGGGTTTCATGAGCTGCACTTCTTTCCTCTCCATGTGGTTGAGCAACACTTCCACCGCTGCTATGGTAATGCCTATTGTGGATGCTGTGCTGTGTCAGCTCAATAGCGCCGCCCCAGAGGAGAAAGCCTTAACCGACTCTAAAACCAGCACATCTCAGAATAACGAGGATACTACAAAGATTGATTTAACATCTTTTCCAGAAAGCAATAACATGTTGGATAATGGCATCGCAAACACAGAAGAACGGGAGGAGGAGCCAACATTCGCAGCCCGCGCCTATGCAAAACAGGGTAAAACTGGTCGCTTCTACAAAACTAAGCGCGATCACATGATGTGCAAAGCTTTCTCGCTGGGGATTGCCTACTCTTCCACCATCGGTGGGATGTCCACGCTGACTGGCACATCTACCAACCTCATATTTATAGAACAGTTTGAAACCCGCTACCCTGGGTGCCAGCTCGTAAACTTTGGATCTTGGATCGCCTTTTCCTTTCCCATCGCCTTTATCATCTTGATACTTTCCTGGTTGTGGATCAACTGGCTTTTCCTTGGCTGTAGTTATAAAGACATGCAGTGCTGTGGAAAATCAAAGTCGCCCACTGACCTGGACTCAAGAAATATCCTGAAACAAGAATACGACAAGATGGGACCTCTCAGCTACCAAGAGGTGGTAACGCTAGTGATCTTCCTGCTGATGGCCCTGTCTTGGTTTACTCGGGACCCTGGATTTATCCCAGGTTGGGATTCACTGTTTGGACTTAAAGGATACAAATCTGATGCTACCTCAGCCATTCTCTTTGGATTTTTATTATTTATTATCCCAGGAAGGAAGCCTGGCTGGTTGTGCTGTAGATCTAAAGGGAAGTCCCGAACTCCTCAAGCTGCAGAATCTACTCCGATGATAACGTGGAAGGAATTTGAAGACTGTATACCCTGGCATATTGTCATCTTAGTTGGAGGGGGCTTTGCCCTCGCCAAGGGGTGTGAAGTGTCAGGACTCTCTACCTGGGTGGGGCACAGGATGGTACCTCTCAGTAGTCTGCCAGGCTGGATCATTGTATTTATTGTGTGTCTGATTGTGACCTCGGTGACGGAAGTTGCAAGCAACCCCGCTACGATTACGATATTCCAACCCATTCTTTCCTCACTGGCTGAAGGAATAGGAGTCAACCCACTCTTCGTCATCATCCCAGCAACAATAAGTGCCTCATGTGCTTTCCTCTTGCCGGTGGCCAATCCCCCGAATGCCATTGTGTTTTCCTACGGACATCTGACCGTGCCAGACATGATCAAAGCCGGACTGGGCACAAATGTCATCAGCATGTTGGCGCTGTGGTTCGGGCTGTACGTTTGGGGAATACCAATGTTCGATCTGAACAGCTTCCCGGAGTGGGCATCCCATAAGAACATGACATCACTAGCAGCACCATAA
Full Trace Sequence: cggagagaagctgcaggggagggggggtggctcatcctgcagcactgactgcatttttctgcctttccgtgcattctcctgccccagccccagcctccttgccccttctcctgccccagcctccttgccccttctcctgccccagcccgggcctccttgcccttctcctgccccagcctgtgcattccctggatgtattccccggacctgccgcctctggagcgccccatacccgtgtggatcccgggcttgctgtgcctgcagatggccatgtcatttctccgccagctctggcagcagaaggatgtgctcattactttcctgctgcctcttctcttcctgcccctgcccctggcaactcagagcaaggaagcagcatgtgcttacatcttattggtcactgccgtttactggatatcagaggccatcccactcggtgccgccgctttggttcctgccttcttattcccactctttggcatcatgaaatcaagtgaggtggcatctgaatactttaaagacattcatctcctcttattcggcgttgtgtgtttggccgcctccatccagaagtggaacctgcacaaacggatagcgctttggatggtcctgtctgttggaagcaagcccagctggcttcttttgggtttcatgagctgcacttctttcctctccatgtggttgagcaacacttccaccgctgctatggtaatgcctattgtggatgctgtgctgtgtcagctcaatagcgccgccccagaggagaaagccttaaccgactctaaaaccagcacatctcagaataacgaggatactacaaagattgatttaacatcttttccagaaagcaataacatgttggataatggcatcgcaaacacagaagaacgggaggaggagccaacattcgcagcccgcgcctatgcaaaacagggtaaaactggtcgcttctacaaaactaagcgcgatcacatgatgtgcaaagctttctcgctggggattgcctactcttccaccatcggtgggatgtccacgctgactggcacatctaccaacctcatatttatagaacagtttgaaacccgctaccctgggtgccagctcgtaaactttggatcttggatcgccttttcctttcccatcgcctttatcatcttgatactttcctggttgtggatcaactggcttttccttggctgtagttataaagacatgcagtgctgtggaaaatcaaagtcgcccactgacctggactcaagaaatatcctgaaacaagaatacgacaagatgggacctctcagctaccaagaggtggtaacgctagtgatcttcctgctgatggccctgtcttggtttactcgggaccctggatttatcccaggttgggattcactgtttggacttaaaggatacaaatctgatgctacctcagccattctctttggatttttattatttattatcccaggaaggaagcctggctggttgtgctgtagatctaaagggaagtcccgaactcctcaagctgcagaatctactccgatgataacgtggaaggaatttgaagactgtataccctggcatattgtcatcttagttggagggggctttgccctcgccaaggggtgtgaagtgtcaggactctctacctgggtggggcacaggatggtacctctcagtagtctgccaggctggatcattgtatttattgtgtgtctgattgtgacctcggtgacggaagttgcaagcaaccccgctacgattacgatattccaacccattctttcctcactggctgaaggaataggagtcaacccactcttcgtcatcatcccagcaacaataagtgcctcatgtgctttcctcttgccggtggccaatcccccgaatgccattgtgttttcctacggacatctgaccgtgccagacatgatcaaagccggactgggcacaaatgtcatcagcatgttggcgctgtggttcgggctgtacgtttggggaataccaatgttcgatctgaacagcttcccggagtgggcatcccataagaacatgacatcactagcagcaccataaccgcaatggacccgcgctttttctaaaatccaatcgtttacagggagcgatggcattcttggttcggaggacagagtagaataagcagaggaaggcagctaggagcacacggccttgggcatgggcatctttttttctcacttctcctttgttcacgtttctagggcactcttgcaacttaaacccttttgctgccaaaaggaaagagcgcatttcttactgctttaaaaaaaaaaaaatgactttggtgcttccagaaagatagtggaatgcagtgctctgtaggcaagtaacacattcccgcacctagacaggtattttgtacctgtattggcccctataggaacgcactgcaccttgaacacagctccaaatgctcttgtgtgtgcataccctaaatggggcaactttttaaagttgttcagttaaagggaaagtaaatatccaactgctgagtaggagctcacactctagaaatcagcacctaggttggctttcattgtcattgtcaaccctcttcatcagatacccacccagctgcacatctgtgggggtaaccagggccctttaagcgtttgattgatgtagttgggtaagggggtcctgagcatggtccccaatgtgtttagcgcagtttacttctcctttataggggcttttcacctttgaattaacttttaatacaatgtagcgagtgccattctgagacagtttgcaatgtagaagctgaaacgtatactagctcattaggtaccggaacaaagcaatgctcgtggtctttaccaccaatttcaaaggtcaaaatagatgaaagtgttttgtgcttaaggcttaaaacttaacctttattaatttattaataaaggccaaattcacaagactaacaacaaaggacaaaggaataaaagcaatggatatttgtgccagaatatacattgcattaaggttattcaactaaattgattttactgaattcatatatttacactattatagatatggcgttcccataccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSFLRQLWQQKDVLITFLLPLLFLPLPLATQSKEAACAYILLVTAVYWISEAIPLGAAALVPAFLFPLFGIMKSSEVASEYFKDIHLLLFGVVCLAASIQKWNLHKRIALWMVLSVGSKPSWLLLGFMSCTSFLSMWLSNTSTAAMVMPIVDAVLCQLNSAAPEEKALTDSKTSTSQNNEDTTKIDLTSFPESNNMLDNGIANTEEREEEPTFAARAYAKQGKTGRFYKTKRDHMMCKAFSLGIAYSSTIGGMSTLTGTSTNLIFIEQFETRYPGCQLVNFGSWIAFSFPIAFIILILSWLWINWLFLGCSYKDMQCCGKSKSPTDLDSRNILKQEYDKMGPLSYQEVVTLVIFLLMALSWFTRDPGFIPGWDSLFGLKGYKSDATSAILFGFLLFIIPGRKPGWLCCRSKGKSRTPQAAESTPMITWKEFEDCIPWHIVILVGGGFALAKGCEVSGLSTWVGHRMVPLSSLPGWIIVFIVCLIVTSVTEVASNPATITIFQPILSSLAEGIGVNPLFVIIPATISASCAFLLPVANPPNAIVFSYGHLTVPDMIKAGLGTNVISMLALWFGLYVWGIPMFDLNSFPEWASHKNMTSLAAP
Donor tissue: neurula