ORFeome > slc16a12 – XORFeome 2.0

slc16a12 – XORFeome 2.0

General Information

Species: Xenopus tropicalis solute carrier family 16 (monocarboxylic acid transporters), member 12, mRNA (cDNA clone MGC:76256 IMAGE:5379098), complete cds
Gene Symbol: slc16a12
Gene ID: 394932
ORF gb_acc: MG132767
ORF ID: 10073

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064255

Library Location

Plate ID: GDExt11002
Well Location: E02

EST Sequences

Clone: MGC:76256 IMAGE:5379098
Trimmed Sequence: ATGACACAAGAGAAGCGGAATTTGCACAAAGCGCCACCTGATGGAGGCTGGGGATGGATGATTGTGATTGGCTGCTTTTTCGTTACTGTTTGTACTCGTGCAGTTACAAGGTGCATATCTATATTCTTTGTAGAGTTCCAGTCATATTTTGCTCAAGACTATGCAAGGACTGCTTGGATACATTCCATTGTTGACTGCTCCACTATGCTGTGTGCTCCGATTGGAAGCTACGTGAGTAATCATTTCTCCTGTCAAGTGGGCATCATACTAGGAGGAGTGCTCGCATCCACTGGACTAGTTCTGAGTTCTTTTGCCACAAGCCTGGAGTATCTCTACCTCACTCTGGGTGTGCTCACAGGTCTTGGATTTGCACTTTGTTACAGCCCTGCCATTGCAATGGTGGGCAAATACTTTGAGAAAAGGAAAGCTTTAGCCTATGGCATCGCAATGTCAGGGAGTGGCATTGGCACCTTTATTTTAGCCCCTGTGGTTCAACTGCTCATTGAACAGTTTTCCTGGCGGGGGGCATTACTCATCCTTGGCGGATTTGTTTCAAACTTGTGCGTTTGCGGTGCTTTGATGCGGCCCATTACCCTTAAGGAGGACTCATTGCATTATCCGCTCAAACAAGAACAGATGGAGAATGAGCCAACCCAGAGCGGTCGGCTGGATTCCTCGTGCTCGCCACTGTGCCAGGACTGTTCTCATAAGAGACTTTGCTACTGCACCAAAAAGGAATACAGTTTTTTACTAAAACCAAAGTTCATGGTACTTGCAGTGTCCTTTCTTTTCCTGGCCTATGGATGTAGCCCTCCCTTTGTGTACCTTGTGCCTTATGCTCTAAATGTGGGAGTGAGCAACCAAGAAGCTGCTTTCCTGATGTCAATTCTTGGAATCATAGACATTGTTGGTAACATCACCTTCGGTTGGGTAACTGACACAAGGTTCCTGAAGAAGCATCGATACTGCTGCTACCTCATAGCCGTGGGGCTGGACGGCCTCTGCTGCCTGTTTCTTCCTATCCTGACGCGCTTCCAGCTGCTCGTGCCTTTCTCTGTCATGTTTGGATACTTCGATGGGGCCTACGTGGCTCTCATTCCTGTCGTTACTGGAGATGTCGTGGGAACCTCAAGTTTGTCCTCTGCCTTGGGTGTGGTGTTCTTCCTGCATGCAGTGCCGTATTTGGTGAGCCCGCCCATTGCAGGTTGGCTGGTGGATACGACCGGTGACTACACAGCAGCATTCCTTCTTAGTGGATTCTCTATGATATTCTGCGCTGTTCTGTTGGCTCTGGCTAAAATAATAAATAGGATAAAGAAGAGACCCAAGGCTGTAGCTGTGCCCACTTCTGATATAAAGCAAGAAATCTGGACTAATGGAGACGTGTCCTGTGCAAATGCGATCAACCAAAAAGAGGTGTAG
Full Trace Sequence: agctgtggcacttgggcagctgtttgccaagcacaacctatgatgatgaaaaaaatctctaaaataagctaacaatcgtgggacattccgcatgtcgccggatactttgctgcatttggaagtgatcacatatgagcgaagcagtgcttccaaatcctctacccatttgaagtggcatcttcggtgtagaaaaaagcattttaaaaccaagaatgacacaagagaagcggaatttgcacaaagcgccacctgatggaggctggggatggatgattgtgattggctgctttttcgttactgtttgtactcgtgcagttacaaggtgcatatctatattctttgtagagttccagtcatattttgctcaagactatgcaaggactgcttggatacattccattgttgactgctccactatgctgtgtgctccgattggaagctacgtgagtaatcatttctcctgtcaagtgggcatcatactaggaggagtgctcgcatccactggactagttctgagttcttttgccacaagcctggagtatctctacctcactctgggtgtgctcacaggtcttggatttgcactttgttacagccctgccattgcaatggtgggcaaatactttgagaaaaggaaagctttagcctatggcatcgcaatgtcagggagtggcattggcacctttattttagcccctgtggttcaactgctcattgaacagttttcctggcggggggcattactcatccttggcggatttgtttcaaacttgtgcgtttgcggtgctttgatgcggcccattacccttaaggaggactcattgcattatccgctcaaacaagaacagatggagaatgagccaacccagagcggtcggctggattcctcgtgctcgccactgtgccaggactgttctcataagagactttgctactgcaccaaaaaggaatacagttttttactaaaaccaaagttcatggtacttgcagtgtcctttcttttcctggcctatggatgtagccctccctttgtgtaccttgtgccttatgctctaaatgtgggagtgagcaaccaagaagctgctttcctgatgtcaattcttggaatcatagacattgttggtaacatcaccttcggttgggtaactgacacaaggttcctgaagaagcatcgatactgctgctacctcatagccgtggggctggacggcctctgctgcctgtttcttcctatcctgacgcgcttccagctgctcgtgcctttctctgtcatgtttggatacttcgatggggcctacgtggctctcattcctgtcgttactggagatgtcgtgggaacctcaagtttgtcctctgccttgggtgtggtgttcttcctgcatgcagtgccgtatttggtgagcccgcccattgcaggttggctggtggatacgaccggtgactacacagcagcattccttcttagtggattctctatgatattctgcgctgttctgttggctctggctaaaataataaataggataaagaagagacccaaggctgtagctgtgcccacttctgatataaagcaagaaatctggactaatggagacgtgtcctgtgcaaatgcgatcaaccaaaaagaggtgtagataaggagcaaacaatatgctgttgttaagcagcttcctagcaatcccacgcctgaaggacttccataagattgcacagagcgggcattgggaaggaatcgccaaaacggaataagcttgagttgcacaccggccacacagagcctgcacattataatgccatgatggatggacataaataaacggttgggtaatgatactctcagttaagaagaatattttttgccttaagtataactattacccagaagcagctgtacagcttcatatctgggagactttgccttttttctccttaacatcaggctaaattcagattatcacgaggagacgatactgtgaaagatcggttaatcaagtcttcctgattcaggactggaatacagtgccacttacttgaatggatgtggggtgggtcagtggatgtcaatcagtaaagccattaaaatggatgataatgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTQEKRNLHKAPPDGGWGWMIVIGCFFVTVCTRAVTRCISIFFVEFQSYFAQDYARTAWIHSIVDCSTMLCAPIGSYVSNHFSCQVGIILGGVLASTGLVLSSFATSLEYLYLTLGVLTGLGFALCYSPAIAMVGKYFEKRKALAYGIAMSGSGIGTFILAPVVQLLIEQFSWRGALLILGGFVSNLCVCGALMRPITLKEDSLHYPLKQEQMENEPTQSGRLDSSCSPLCQDCSHKRLCYCTKKEYSFLLKPKFMVLAVSFLFLAYGCSPPFVYLVPYALNVGVSNQEAAFLMSILGIIDIVGNITFGWVTDTRFLKKHRYCCYLIAVGLDGLCCLFLPILTRFQLLVPFSVMFGYFDGAYVALIPVVTGDVVGTSSLSSALGVVFFLHAVPYLVSPPIAGWLVDTTGDYTAAFLLSGFSMIFCAVLLALAKIINRIKKRPKAVAVPTSDIKQEIWTNGDVSCANAINQKEV
Donor tissue: tailbud