ORFeome > slc27a6 – XORFeome 2.0

slc27a6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis solute carrier family 27 (fatty acid transporter), member 6, mRNA (cDNA clone MGC:97586 IMAGE:6977289), complete cds
Gene Symbol: slc27a6
Gene ID: 496813
ORF gb_acc: MG134450
ORF ID: 12151

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088505

Library Location

Plate ID: GDExt11021
Well Location: B03

EST Sequences

Clone: MGC:97586 IMAGE:6977289
Trimmed Sequence: ATGGCTCTGCCTTGGATTGCAGCAGGGCTGGCCGGCTTGCTAGCGCTGCATTTCTTACAAAAGACATGTTTCCCTTACTTTTGGGCTGACCTCATATACCTTTTGAAAGTAGTGCGATATGGACTCCGCATTGAGATATACAAGAGGACGGGCAGTGTTGTCACAGTGGTCGATAACTTTATGGAGCAAGCTAGACGGGTGCCAAACAAACCCTTCCTAATATATCAGGAACAAGTGTACACCTACCGGGATGTGGACAGAAGGAGCAATCAGGTGGCTCAGGTGTTCATGAAATATTCCCCTCTGGAAAAGGAGGATACGGTAGCCATGCTGATGAGCAATGAGCCCGACTTCTTGAATGTATGGTTTGGTCTGGCCAAGCTTGGCTGTCGCCTTGCATTTCTGAACTACAACATTCGCTCCAGGTCGCTGCTGCACTGCTTCCACAGTAGTGGGGCCAAGATGCTGATTGTGGGAGCAGATATGGTAGAAACACTAGAGGAAATCCTGCCAAATTTACAGGAAGATAATATCAGCGTTTGGGTAATGGCAAAAGAAGTTTCAATCAAAGGTGTGAATACTATTCTGGACAAACTGGAACATGTAACGGACAAGCCAGTACCGCAGCACTTGCGTCATGTCTCCAGCATCAGAGCAGCAACTCTTTATATTTTCACTTCTGGGACTACAGGTCTTCCCAAGGCTGCCCTTATTAGTCAACTGCAAACACTAAAAGGCGCTGCTGGCATCTGGGCATTTGGTGGCACAGAGGATGACATTGTTTATATAACACTTCCTCTTTACCATAGTGCAGCCTCTCTCATTGGAATAGGTGGAAGCATTTATCTGGGTGCTACTTGTGTCCTGAAAAAGAAATTTTCAGCAAGCCAGTTTTGGATTGACTGTAAAAAACATAATGTTACAGTTGTTCAGTATATTGGAGAACTGTGCCGCTATTTGTGTAACCAGCCTTTGAAAGAAGGGGAAAAAGATCACAAAGTCAGAATGGCAGTCGGAAATGGTGTACGTAGTGACGTATGGAAAGAATTTATCCGAAGATTTGGGGATATAAAGATGTGTGAGCTCTATGGTGCTACTGAAGGAAACATTTGTTTTATGAATCACACAGGAAAAATTGGATCTGTTGGACGATCGAATATATTTTATAAGCTGCTGTTCCCATTTGAATTGATAAAATACGACATTCAAAAAGATGAGCCAATAATTAACGAACAGGGCTGGTGTGAACGTGTTAAAAAAGGGGAAACAGGACTTTTAATATCACAGGTGAACAAAAACAACCCTTTCTTCGGCTACGCGGGGAATAAAAACCACACAACTAAAAAGCTGTTATGCAATGTCTTCAGAAAAGGGGATGTTTATTTCAACACTGGCGATTTGATGGTCCAGGACAGTGAAAATTTTCTTTATTTTAGAGACAGAATTGGTGACACCTTCAGGTGGAAAGGAGAAAATGTTGCTACTACAGAAGTAGCTGACATTATTGGAATGCTGAACTTCATACAAGAAGCCAATATATATGGAGTGGCCATTCCAGAACATGAAGGAAAAGTTGGAATGGCATCCATCATAGTAAAAGCCAATGAAACATTAGACGTTAAGACCATTTATGAACAAATTGTGACCTACCTACCTGGCTATGCTCGTCCTCGTTTTCTAAGGCTACAGGAAAACATGGAGATGACGGGAACATTCAAACAGCAAAAATTCCGTCTTGTGGAACAAGGCTTCAATCCATCAGCCGTGCCTGATCCACTTTATTTCTTAGATGATTCTGAAAAATCCTATGTCCCACTGACCAAAGACATTTATGACAAAATCTTGAGTGGCCAGATAAAACTCTAG
Full Trace Sequence: ggcgctcccaagtgcaactctaactgctgggcttttctagtttcgccatcagctgatctccccatggctctgccttggattgcagcagggctggccggcttgctagcgctgcatttcttacaaaagacatgtttcccttacttttgggctgacctcatataccttttgaaagtagtgcgatatggactccgcattgagatatacaagaggacgggcagtgttgtcacagtggtcgataactttatggagcaagctagacgggtgccaaacaaacccttcctaatatatcaggaacaagtgtacacctaccgggatgtggacagaaggagcaatcaggtggctcaggtgttcatgaaatattcccctctggaaaaggaggatacggtagccatgctgatgagcaatgagcccgacttcttgaatgtatggtttggtctggccaagcttggctgtcgccttgcatttctgaactacaacattcgctccaggtcgctgctgcactgcttccacagtagtggggccaagatgctgattgtgggagcagatatggtagaaacactagaggaaatcctgccaaatttacaggaagataatatcagcgtttgggtaatggcaaaagaagtttcaatcaaaggtgtgaatactattctggacaaactggaacatgtaacggacaagccagtaccgcagcacttgcgtcatgtctccagcatcagagcagcaactctttatattttcacttctgggactacaggtcttcccaaggctgcccttattagtcaactgcaaacactaaaaggcgctgctggcatctgggcatttggtggcacagaggatgacattgtttatataacacttcctctttaccatagtgcagcctctctcattggaataggtggaagcatttatctgggtgctacttgtgtcctgaaaaagaaattttcagcaagccagttttggattgactgtaaaaaacataatgttacagttgttcagtatattggagaactgtgccgctatttgtgtaaccagcctttgaaagaaggggaaaaagatcacaaagtcagaatggcagtcggaaatggtgtacgtagtgacgtatggaaagaatttatccgaagatttggggatataaagatgtgtgagctctatggtgctactgaaggaaacatttgttttatgaatcacacaggaaaaattggatctgttggacgatcgaatatattttataagctgctgttcccatttgaattgataaaatacgacattcaaaaagatgagccaataattaacgaacagggctggtgtgaacgtgttaaaaaaggggaaacaggacttttaatatcacaggtgaacaaaaacaaccctttcttcggctacgcggggaataaaaaccacacaactaaaaagctgttatgcaatgtcttcagaaaaggggatgtttatttcaacactggcgatttgatggtccaggacagtgaaaattttctttattttagagacagaattggtgacaccttcaggtggaaaggagaaaatgttgctactacagaagtagctgacattattggaatgctgaacttcatacaagaagccaatatatatggagtggccattccagaacatgaaggaaaagttggaatggcatccatcatagtaaaagccaatgaaacattagacgttaagaccatttatgaacaaattgtgacctacctacctggctatgctcgtcctcgttttctaaggctacaggaaaacatggagatgacgggaacattcaaacagcaaaaattccgtcttgtggaacaaggcttcaatccatcagccgtgcctgatccactttatttcttagatgattctgaaaaatcctatgtcccactgaccaaagacatttatgacaaaatcttgagtggccagataaaactctagtttatctttaagttgatgtgaatttctggggcatgggttagcagtagtatgtggtctaacagcagttccatccacttgaacttagacaatttttaacagcagctataaatcccaatacaacgaatagactgatgtacttcttgggggggggcaatagacgatctccagtttaacctaaagccttactgaacctcacaactggaaaactttctactgtccagattacagattgttttcagccagaagtaattgctgacagattgacaaaagcttattccatttttatttacagttacgtcaatgtatgggttatttaatagtcatgcataacagtttaaagctgcagcatttgtgaaagctacttttatctaatacacattcctcagaattgtctagaaaggcagttaataaagtatcaccattaatgtgaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MALPWIAAGLAGLLALHFLQKTCFPYFWADLIYLLKVVRYGLRIEIYKRTGSVVTVVDNFMEQARRVPNKPFLIYQEQVYTYRDVDRRSNQVAQVFMKYSPLEKEDTVAMLMSNEPDFLNVWFGLAKLGCRLAFLNYNIRSRSLLHCFHSSGAKMLIVGADMVETLEEILPNLQEDNISVWVMAKEVSIKGVNTILDKLEHVTDKPVPQHLRHVSSIRAATLYIFTSGTTGLPKAALISQLQTLKGAAGIWAFGGTEDDIVYITLPLYHSAASLIGIGGSIYLGATCVLKKKFSASQFWIDCKKHNVTVVQYIGELCRYLCNQPLKEGEKDHKVRMAVGNGVRSDVWKEFIRRFGDIKMCELYGATEGNICFMNHTGKIGSVGRSNIFYKLLFPFELIKYDIQKDEPIINEQGWCERVKKGETGLLISQVNKNNPFFGYAGNKNHTTKKLLCNVFRKGDVYFNTGDLMVQDSENFLYFRDRIGDTFRWKGENVATTEVADIIGMLNFIQEANIYGVAIPEHEGKVGMASIIVKANETLDVKTIYEQIVTYLPGYARPRFLRLQENMEMTGTFKQQKFRLVEQGFNPSAVPDPLYFLDDSEKSYVPLTKDIYDKILSGQIKL
Donor tissue: tailbud