ORFeome > sp5 – XORFeome 2.0

sp5 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Sp5 transcription factor, mRNA (cDNA clone MGC:76071 IMAGE:5307698), complete cds
Gene Symbol: sp5
Gene ID: 394696
ORF gb_acc: MG132743
ORF ID: 10045

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062500

Library Location

Plate ID: GDExt11001
Well Location: F01

EST Sequences

Clone: MGC:76071 IMAGE:5307698
Trimmed Sequence: ATGGCTGCTGTGGCTGTCCTAAGGAATGATTCTCTCCAGGCTTTCCTACAGGACAGGACCCCTAGTGCATCCCCAGACGTTGGTAAGCACTCACCCTTGGCTCTTCTGGCAGCTACTTGTAGTCGTATTGGCCAGCCAGGTACAGGTCCTGCTGATTTTATTCAGTTTCCCTATGACCCAACAATTGGATCTCCATCTAGGATTTTCCACCCATGGACTAATGAAATATCGGCACATTCTTCTGGTGGAATTCAACCTCACAATGGCATTGGACTTAGCACCTCAAAAACACAACTGGCCTCTCACATCCAGTCTTCCTTTGTCACTCATGAATTACCCTTGACACCACCGGCAGACCCTTCCTATCCTTATGACTATTCTCCAATGAAGATGTTACCTCCCCCCATGGCTGCTTTTCAGACTGGTTGCCAGTCTCCGTATGTGCCTGCTGTTCCTTATGCACCCCCAGCCCCTATTACTTCTGCTCTTCATGGGTTTGTACCGAGCCATTCAAACCTGATACACCAGCAGCCAAGGCAACTCTCTCCTAATCCAGCAGAAGACATGCCCTGGTGGAGTATTCAGCAAGCCACACCAGTCGCCCATGCTTCTACTATTCCTCATCCCCATCACCGGTTTCCCATCCAGAGAAGTTTAGTTTTAGGGCATTCAGATTTTGCACAATATCAGACTCAGATTGCTGCACTACTGCAAACAAAATCTCCTCTAGCCACAGCCAGGAGATGCAGAAGATGCAGGTGTCCCAACTGCCAAACTTCCAGTGGTCCTGATGAGGCAGGCAAAAAAAAGCAGCACATCTGCCACATCCCAGGCTGTGGAAAAGTTTATGGCAAAACTTCCCATTTAAAGGCACATTTGAGGTGGCACTCTGGGGAAAGACCTTTTATTTGCAACTGGCTGTTCTGTGGCAAAAGCTTCACCAGATCAGATGAATTACAGAGGCACTTGAGGACACATACGGGTGAGAAGAGGTTTGTCTGCCCGGAATGTGGCAAAAGGTTCATGAGAAGCGACCACCTGGCAAAACACGTAAAAACCCATCAAAACAAGAAGATAAAAAGTGTAGAAAGGACAGTGAAGCAGGAACATAACAGGGACCATTAG
Full Trace Sequence: ggcagtgagtggcgcggctgctgagggaggaggagagctgggaggaggggaggctacctcactaactggtgcccccaactgcttcatgtatctccaccagtgtcctgctcatcatcaggcacctgtaggagctggactatggctgctgtggctgtcctaaggaatgattctctccaggctttcctacaggacaggacccctagtgcatccccagacgttggtaagcactcacccttggctcttctggcagctacttgtagtcgtattggccagccaggtacaggtcctgctgattttattcagtttccctatgacccaacaattggatctccatctaggattttccacccatggactaatgaaatatcggcacattcttctggtggaattcaacctcacaatggcattggacttagcacctcaaaaacacaactggcctctcacatccagtcttcctttgtcactcatgaattacccttgacaccaccggcagacccttcctatccttatgactattctccaatgaagatgttacctccccccatggctgcttttcagactggttgccagtctccgtatgtgcctgctgttccttatgcacccccagcccctattacttctgctcttcatgggtttgtaccgagccattcaaacctgatacaccagcagccaaggcaactctctcctaatccagcagaagacatgccctggtggagtattcagcaagccacaccagtcgcccatgcttctactattcctcatccccatcaccggtttcccatccagagaagtttagttttagggcattcagattttgcacaatatcagactcagattgctgcactactgcaaacaaaatctcctctagccacagccaggagatgcagaagatgcaggtgtcccaactgccaaacttccagtggtcctgatgaggcaggcaaaaaaaagcagcacatctgccacatcccaggctgtggaaaagtttatggcaaaacttcccatttaaaggcacatttgaggtggcactctggggaaagaccttttatttgcaactggctgttctgtggcaaaagcttcaccagatcagatgaattacagaggcacttgaggacacatacgggtgagaagaggtttgtctgcccggaatgtggcaaaaggttcatgagaagcgaccacctggcaaaacacgtaaaaacccatcaaaacaagaagataaaaagtgtagaaaggacagtgaagcaggaacataacagggaccattagtggaagcctgacacgtgtacctgtagtgcagtatacactacgctgggtactcacattggattcataacgcccattcagatgtaaatggtgatacagttgcagaacttgtctcacctgtatatttgtacaggtctccgtcagatttgttttttttccactattgctgtcttggagaggataccttgttttcatactctgtgtatatttctgttaataattaaagtaagtatggaaatcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAVAVLRNDSLQAFLQDRTPSASPDVGKHSPLALLAATCSRIGQPGTGPADFIQFPYDPTIGSPSRIFHPWTNEISAHSSGGIQPHNGIGLSTSKTQLASHIQSSFVTHELPLTPPADPSYPYDYSPMKMLPPPMAAFQTGCQSPYVPAVPYAPPAPITSALHGFVPSHSNLIHQQPRQLSPNPAEDMPWWSIQQATPVAHASTIPHPHHRFPIQRSLVLGHSDFAQYQTQIAALLQTKSPLATARRCRRCRCPNCQTSSGPDEAGKKKQHICHIPGCGKVYGKTSHLKAHLRWHSGERPFICNWLFCGKSFTRSDELQRHLRTHTGEKRFVCPECGKRFMRSDHLAKHVKTHQNKKIKSVERTVKQEHNRDH
Donor tissue: gastrula