ORFeome > sugt1 – XORFeome 2.0

sugt1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SGT1, suppressor of G2 allele of SKP1, mRNA (cDNA clone MGC:69449 IMAGE:5335926), complete cds
Gene Symbol: sugt1
Gene ID: 548910
ORF gb_acc: MG134240
ORF ID: 11899

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090589

Library Location

Plate ID: GDExt11019
Well Location: A03

EST Sequences

Clone: MGC:69449 IMAGE:5335926
Trimmed Sequence: ATGACAGAGAGAGCTGTTCCCCCTACACTATCCTTTACTGACAGTTATATTGGTGCAGACCCTCAGAAATCCTTAGAGGAATTGACAAAGGCTATAGAAGAGAAATCTGACTGTGCAGAATATTATTGCCAAAGAGCCTATGCCCACATACTTCTCCAAAATTACAATGATGCTGTTTTGGATGCAAAGAGGTCCCTGGAGCTCCAGCCTAACAATGCGAGTGCTTTCCTCAGGAAGGGGGAGGCTGAATTTCATTTACAGAATTATTCTTCTGCTGAAGAAAGTTTCAAAAAAGGGCAAATATTAGATGCCTCCACTCCCACATTTCCTACTTGGATTAAACTATGTGAGGAAAAGCTAAATGTTTCAACAGAAGGGCAATCGAGTAACAACCAGCAGACGTCAGTGAAATACAGGCATGACTGGTATCAAACAGAATCTCACATCATCATTACAGTAATGATCAAGAACGTACAGAAGAATAATGTCCACATACGGTTTTCAGAAAGAGAGTTAACCGTTAATATGAGTCTACCTTCTGGAGAAAACTACAGCTTAAATCTGCATCTCCTTCACGCCATCGTACCTGACCAGAGTATATTCAAGGTGCTTTCAACGAAGGTAGAGATAAAATTGAAGAAAACTGAGGCAATGCGTTGGGAAACATTAGAAGGCAAGGCAGATAGTCAAGTGAAGCATTTTACTCAAGAATCCATGCACAAATACCCCTCTTCCTCACACTATACTAAGAACTGGGATAAACTGGTGGGTCAGATCAAAGAGGAGGAGAAAAATGAAAAACTGGAAGGGGATGCTGCACTAAATCAACTTTTTCAGCAGATTTACTCAGATGGGAACGATGAAGTGAAACGCGCCATGAACAAGTCATTTATGGAGTCAGGAGGAACCGTGCTGAGCACCAACTGGACAGATGTGGGCAAGAAGAAAGTAGACGTAAATCCCCCAGATGATATGGAATGGAAACAATACTAG
Full Trace Sequence: gtttgtttggcattccctgcggtccggcctggggattcactgagctgcagttggagcgatctgtttgctgtgtgtagcacgtacagtgccagctagagaaactcaagggtcaaaataaagaggtagctcctaatacataaacatgacagagagagctgttccccctacactatcctttactgacagttatattggtgcagaccctcagaaatccttagaggaattgacaaaggctatagaagagaaatctgactgtgcagaatattattgccaaagagcctatgcccacatacttctccaaaattacaatgatgctgttttggatgcaaagaggtccctggagctccagcctaacaatgcgagtgctttcctcaggaagggggaggctgaatttcatttacagaattattcttctgctgaagaaagtttcaaaaaagggcaaatattagatgcctccactcccacatttcctacttggattaaactatgtgaggaaaagctaaatgtttcaacagaagggcaatcgagtaacaaccagcagacgtcagtgaaatacaggcatgactggtatcaaacagaatctcacatcatcattacagtaatgatcaagaacgtacagaagaataatgtccacatacggttttcagaaagagagttaaccgttaatatgagtctaccttctggagaaaactacagcttaaatctgcatctccttcacgccatcgtacctgaccagagtatattcaaggtgctttcaacgaaggtagagataaaattgaagaaaactgaggcaatgcgttgggaaacattagaaggcaaggcagatagtcaagtgaagcattttactcaagaatccatgcacaaatacccctcttcctcacactatactaagaactgggataaactggtgggtcagatcaaagaggaggagaaaaatgaaaaactggaaggggatgctgcactaaatcaactttttcagcagatttactcagatgggaacgatgaagtgaaacgcgccatgaacaagtcatttatggagtcaggaggaaccgtgctgagcaccaactggacagatgtgggcaagaagaaagtagacgtaaatcccccagatgatatggaatggaaacaatactagttatcctgctgcagtccgtacgtttattgaagcagtctgatgcacaacaagctgatgagacatcactccttaccttttgcgccctttcttttcccagaatgctaattgtttgctgcttccattaaatgttgcacaaagtgaatgaaatgacaagcgagcctaatcctttattcctgttttgttaggagccagccctgtagtatgtatatagtgatttctgatgcacattcactcagataacttattggccggaggtgcagctctcctgtcagcttgttggaaatctttctcactgacccactcttggcctttttatcaactgcaaattataaatatactttttcaatgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTERAVPPTLSFTDSYIGADPQKSLEELTKAIEEKSDCAEYYCQRAYAHILLQNYNDAVLDAKRSLELQPNNASAFLRKGEAEFHLQNYSSAEESFKKGQILDASTPTFPTWIKLCEEKLNVSTEGQSSNNQQTSVKYRHDWYQTESHIIITVMIKNVQKNNVHIRFSERELTVNMSLPSGENYSLNLHLLHAIVPDQSIFKVLSTKVEIKLKKTEAMRWETLEGKADSQVKHFTQESMHKYPSSSHYTKNWDKLVGQIKEEEKNEKLEGDAALNQLFQQIYSDGNDEVKRAMNKSFMESGGTVLSTNWTDVGKKKVDVNPPDDMEWKQY
Donor tissue: tailbud