ORFeome > t2 – XORFeome 2.0

t2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis T, brachyury homolog, gene 2, mRNA (cDNA clone MGC:76084 IMAGE:5307982), complete cds
Gene Symbol: t2
Gene ID: 407951
ORF gb_acc: MG133458
ORF ID: 10979

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067315

Library Location

Plate ID: GDExt11010
Well Location: A03

EST Sequences

Clone: MGC:76084 IMAGE:5307982
Trimmed Sequence: ATGAGCACAGGCACAGCTGAGAGTTGTGGGAAAAACCTGCCTTGTAGAATGGATCATCTTCTCACAGCTGTAGAGAATGAACTGCAAGTTGGAAGTGAGAAGGGGGACCCCACGGAAAGGGAACTTAAAGTCAATTTAGAAGACACAGACCTTTGGATAAGGTTTAAGGAACTTACCAATGAAATGATAGTTACCAAGAATGGAAGGCGAATGTTTCCTGTGCTGAAAATAAGTGTCACTGGTCTGGACCCAAATGCTATGTACTCTTTTTTAATGGATTTTGTGACTGCTGATAACAACCGCTGGAAGTATGTCAATGGAGAATGGGTTCCAGGTGGCAAACCCGAGCCCCAGGCCCCCAGTTGTGTTTATATCCACCCAGACTCACCCAACTTTGGAGCTCATTGGATGAAAGCACCAGTTTCCTTTAGTAAAGTAAAACTCACCAACAAAATGAATGGAGAAGGCCAGATTATGTTAAATTCGTTGCATAAGTATGAACCCAGAATTCATATAGTAAGAGTTGGGGGACCACAGAAAATGATCACAAGCCATTCATTTCCAGAGACACAGTTCATAGCTGTGACAGCATATCAGAATGAAGAGATTACAGCTCTCAAGATTAAACACAATCCATTTGCTAAAGCTTTCCTTGATGCCAAAGAAAGAAGTGATCACAAGGATTTTATCGATGATGCAGAAAATGGTCAGCAGTCTGGTTACTCACAATTAGGCAATTGGCTGATTCCTGGAACTGGTTCACTCTGTTCTTCTTCCAATCATCATTCTCAGTTTGGAGCACCACTATCAATTCCCTCATCACATGGGTGCGAGAGATATACTACTTTAAGAAACCACCGATCCTCACCTTACCCCAGCCCCTATACCCACAGGAACAATTCTCCTCCAAGCTACACTGAAAACTCATCTGCATGTCTCCCAGTGTTCCAATCCAATGACCACTGGCCTGGTTTACAGATGCAAACCCATACCGGCATGCTGTCAATAAATCACACAAATGGAAGCCCATCTAACTCTTGTCAATATCCAAGTTTATGGTCAGTAAGCAACAGTACAATCGCCCCACTGCCTCAAACAGGATCAGTTGCCAATGGACTTGGGTCACAGTATCTTCGGAGCTCAACATCGCTTTATGCACCATACAATCAGATAGTTCCTTCCCCCACCATGGGATCACCCATATATGAGGGTACCCCCACCGAAATTGAAGAAAACCAATATGATGTCACAGCACATGACAGACTTGCACCTTCTTGGGCTTCTGTGACACCTCCATCATTATAG
Full Trace Sequence: cagagatcttgcactggggactcgtgcagaagaggcatcagcaatacaatgagcacaggcacagctgagagttgtgggaaaaacctgccttgtagaatggatcatcttctcacagctgtagagaatgaactgcaagttggaagtgagaagggggaccccacggaaagggaacttaaagtcaatttagaagacacagacctttggataaggtttaaggaacttaccaatgaaatgatagttaccaagaatggaaggcgaatgtttcctgtgctgaaaataagtgtcactggtctggacccaaatgctatgtactcttttttaatggattttgtgactgctgataacaaccgctggaagtatgtcaatggagaatgggttccaggtggcaaacccgagccccaggcccccagttgtgtttatatccacccagactcacccaactttggagctcattggatgaaagcaccagtttcctttagtaaagtaaaactcaccaacaaaatgaatggagaaggccagattatgttaaattcgttgcataagtatgaacccagaattcatatagtaagagttgggggaccacagaaaatgatcacaagccattcatttccagagacacagttcatagctgtgacagcatatcagaatgaagagattacagctctcaagattaaacacaatccatttgctaaagctttccttgatgccaaagaaagaagtgatcacaaggattttatcgatgatgcagaaaatggtcagcagtctggttactcacaattaggcaattggctgattcctggaactggttcactctgttcttcttccaatcatcattctcagtttggagcaccactatcaattccctcatcacatgggtgcgagagatatactactttaagaaaccaccgatcctcaccttaccccagcccctatacccacaggaacaattctcctccaagctacactgaaaactcatctgcatgtctcccagtgttccaatccaatgaccactggcctggtttacagatgcaaacccataccggcatgctgtcaataaatcacacaaatggaagcccatctaactcttgtcaatatccaagtttatggtcagtaagcaacagtacaatcgccccactgcctcaaacaggatcagttgccaatggacttgggtcacagtatcttcggagctcaacatcgctttatgcaccatacaatcagatagttccttcccccaccatgggatcacccatatatgagggtacccccaccgaaattgaagaaaaccaatatgatgtcacagcacatgacagacttgcaccttcttgggcttctgtgacacctccatcattataggacaaaaacttgtttctattgacatttggcctctgaaaacattaatgcagcttattttacaaatggaaactttatcaagaagataacaagaactgagaaatttcagttgatggtactgtacagaaaatgtggggtccaccagtagatcctaatctttcaatgctcacatcattttgtattaattataaatatacaatatctgcatatgaaacatcaccttcattttaactcattactgtaatgtattcattacacttcataagagcaatgtataacattattgtcaaaaaaacatacacggtgacttgtttttgcaacaaaggatattatttttatctttttaattgtcttaatatattttctgcatttagtttggtaatgtaaataatgaaagtaaaatcaaaaattgttgcaggtgttataataaaataaataaaaatggtaaaacaaattgtaacatataatacctgctagatgctagtaaatcactagccaatttcctaattttgactatttatagctctatttaattataccaatggaaagcatatccagctttgtaggactcctatgatccatagctagaagttggtttggtgaggataaggagatgtgtccttgcaaaaagatggagggacaatacttccacagctttgccttagaactgttccttctgcaaacatgtataatatttataatagtgtataaagtcattttatgttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSTGTAESCGKNLPCRMDHLLTAVENELQVGSEKGDPTERELKVNLEDTDLWIRFKELTNEMIVTKNGRRMFPVLKISVTGLDPNAMYSFLMDFVTADNNRWKYVNGEWVPGGKPEPQAPSCVYIHPDSPNFGAHWMKAPVSFSKVKLTNKMNGEGQIMLNSLHKYEPRIHIVRVGGPQKMITSHSFPETQFIAVTAYQNEEITALKIKHNPFAKAFLDAKERSDHKDFIDDAENGQQSGYSQLGNWLIPGTGSLCSSSNHHSQFGAPLSIPSSHGCERYTTLRNHRSSPYPSPYTHRNNSPPSYTENSSACLPVFQSNDHWPGLQMQTHTGMLSINHTNGSPSNSCQYPSLWSVSNSTIAPLPQTGSVANGLGSQYLRSSTSLYAPYNQIVPSPTMGSPIYEGTPTEIEENQYDVTAHDRLAPSWASVTPPSL
Donor tissue: gastrula