ORFeome > tax1bp1 – XORFeome 2.0

tax1bp1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Tax1 (human T-cell leukemia virus type I) binding protein 1, mRNA (cDNA clone MGC:76179 IMAGE:5335717), complete cds
Gene Symbol: tax1bp1
Gene ID: 394857
ORF gb_acc: MG132688
ORF ID: 9978

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063916

Library Location

Plate ID: GDExt11001
Well Location: F05

EST Sequences

Clone: MGC:76179 IMAGE:5335717
Trimmed Sequence: ATGTCAGCTTTGCAAGAAATCCCATCACCAATCAGCAACATGCAGACATCCAACTTTGCACATGTGATCTTTCAGAATGTGGCTAAGAGTTACCTTCCAAATGCCCCCCTTGAGTGTCATTACACTCTCACTCAATATATCCATCCACATCCAAAAGACTGGGTTGGTATATTTAAGGTTGGTTGGAGCACTCCTCGGGATTATTTTACATTTCTTTGGTCTCTCATGCCAGAAAAATATGTGGCAGAGTCCACTTGTAACTGTGTACTGACTTTTCAAGGATACTATCTTCCTAATGATGATGGCGAGTTTTACCAGTTTTGCTATGTAACCCACAAGGGAGAGATCCGTGGTGCAAGCACACCTTTCCAGTTTCGGGCATCTTCTCCTGTAGATGAACTCTTAACCATGGAAGATGAGGGGCATTCAGACATGTTGGTTGTAACTACTAAAACTGGACTTCTTGAGTTAAAAATTGAAAAAACCATGAAAGAAAAGGAAGAACTTGTAAAAATAACAACTGTGCTTGAAAAGGAAGTGCTACAGTTGAGAGAGCATGTCGAAGGCTTAGAAAGTGAGTTTCTGCGGGAGCAAAAGAGATCTGAACAACTATCTTCAGAGCGAGAGGAATTGTTTAATGCATCAGAAATCTTAAGAAATGAAAGTGATGAAGCCAAAAGAAAATGTAAGGAGATGTCAGCTAAAATTATTCAGCTAGAAGAAGATATCATGTTGGTGACACAGAAGGCAATAGCAAAAGAAACAGAGTTGGACAGCTTGAAAGATAAATTAAAGAAAGTAGTACTGGAGAAAGATCAACTGGAATGTCAGCTGAAATATGAGAAGGATGAAAAAGATCTCTATAAGGTTCATTTGAAGAATACAGAGATTGAAAACACCAAGCTGCTAACTGAGGTCCAGACATTAAAGAACTTGGATACAAACAAAGAAAATCTGATTTCCCACTACAAGGAAGAGCTTGGCAAGCTGCAGATTTGTCTAGCTGATAAAGAAAAAATGAATAAAGAACTTCTGCAGAATTCTTCAAATAAAGAGGATATCGCCTTTTTAAAGCAACAGCTACGAAAATTGGAGGATCAACACCAAGCCAGCAGACAAGAAGTCTCTTTAATGTCTAGGGAATTGAGTGAGGCAGTAAATAAACGTGATAAAACCATGGCCGATCTCCACTCAGCCCGTCTTGACACAGACAGTGTGAGGATGCAACTGGCTGATGCTTTGGCTCAACTAAGTATGCGAGATGAGCAACAGCAGAAGTCCAACCCTTTTGCTAAAAAGGACCAGGGGGCAGACAATAACAGAGTGGAGCAGGAGCTTCGCAAAGAGGTTGAAGACCTGAAGCTGAGATTGCAGATGGCAGCGGACCACTATAAAGATAAATTTAAAGAATGCCAGAAGCTTCAGAAGCAAGTAGTAAAACTCACAGAGCAGCTTAAAGCTACAGAAAATCAGCAGAAAGAAAGAGAACTGTTTTGTGCTACAGAGGCTGCAGCTGTTACAGTTATGAAGCAATGTACTCCACCAGTGAGTCCGTTTACTTCTGATTCTTTACCTGAATTTGACATTAGAGAGCAAGTGCGGGAAATGAGCTTAGAAATGGCTGAAAAAACAGAAAAATATCGCAAGTGTAAGCAAATGCTGGCTGAAGAAAAAGCAAGATGCAGTGCCTATGCTGATGATGTTGCCAAGATGGAACTAAAGTGGAAGGAGCAGCTCAAAGTCAACGACAGCATCAAGCGGCAATTGATTGCTTTGGATGATCAATATAAAGTGCAGTCTGCAGAGAAAGATCGAGAAATATGTGACCTGTCTTATAGTATTGAAACACTTCGTAATGAAAAGGCGAAAATGGAGAGATTTATAAATGATCTTGAGAAAAAACTGGAAAAACAAGCAGGCTGGGCTGCAAGTAACACACAGGGGCTGCAGTTCTTTAATCCATATTGTGATGAACACAGATTAGCTCCTGCCATTCCAGCTCAGCAGCCTCTTCTTCAGTTTGGAAATCCATATGCATCTCAAGAAACTAGAGATGGAGCAGATGGAGCTTTTAATCCAGATGAAGTCCAAGGACCTCCAGTAAGAGCTACCTCCTGGGGTCTCGAGGACAAGGTTGTCTGCAGTCAACCTGCTCGCAACCTTAGTCGGCCTGATGGTTTGGAAGATCCTGATGAAAACAATGCAGGCCTAATTACTAAGGATGAAGACGATGATGATGATGACGATAATGTAAATTTTGAACAAACTCCTGATCCTACACGCATCGCCATGCATGACCAATCAGGCTTCTGCTTTGAAGCAGGGTACACTATGAATAAGAAGTGCCCTCTCTGCCCAGTCTCATTTCCCCCCAACTACGACCAGGGCCAGTTTGAAGCCCACGTGGAGAGTCACTGGAAAGTCTGCCCCATGTGCAACGAGCAGTTCCCCCCAGACTGCGACCAGCAGATCTTCGAGCGGCATGTGCAGACCCACTTTGATGGCAGTGTCTTGAATTTTGACTAA
Full Trace Sequence: tggattattggggtcagacgttccctgcttctgtttctgtcaccatctggctgacgtaggcgcctgtaccggcagaagcacgccagcgcgaccaacgcagccttcaacacaggttaaaatgtcagctttgcaagaaatcccatcaccaatcagcaacatgcagacatccaactttgcacatgtgatctttcagaatgtggctaagagttaccttccaaatgccccccttgagtgtcattacactctcactcaatatatccatccacatccaaaagactgggttggtatatttaaggttggttggagcactcctcgggattattttacatttctttggtctctcatgccagaaaaatatgtggcagagtccacttgtaactgtgtactgacttttcaaggatactatcttcctaatgatgatggcgagttttaccagttttgctatgtaacccacaagggagagatccgtggtgcaagcacacctttccagtttcgggcatcttctcctgtagatgaactcttaaccatggaagatgaggggcattcagacatgttggttgtaactactaaaactggacttcttgagttaaaaattgaaaaaaccatgaaagaaaaggaagaacttgtaaaaataacaactgtgcttgaaaaggaagtgctacagttgagagagcatgtcgaaggcttagaaagtgagtttctgcgggagcaaaagagatctgaacaactatcttcagagcgagaggaattgtttaatgcatcagaaatcttaagaaatgaaagtgatgaagccaaaagaaaatgtaaggagatgtcagctaaaattattcagctagaagaagatatcatgttggtgacacagaaggcaatagcaaaagaaacagagttggacagcttgaaagataaattaaagaaagtagtactggagaaagatcaactggaatgtcagctgaaatatgagaaggatgaaaaagatctctataaggttcatttgaagaatacagagattgaaaacaccaagctgctaactgaggtccagacattaaagaacttggatacaaacaaagaaaatctgatttcccactacaaggaagagcttggcaagctgcagatttgtctagctgataaagaaaaaatgaataaagaacttctgcagaattcttcaaataaagaggatatcgcctttttaaagcaacagctacgaaaattggaggatcaacaccaagccagcagacaagaagtctctttaatgtctagggaattgagtgaggcagtaaataaacgtgataaaaccatggccgatctccactcagcccgtcttgacacagacagtgtgaggatgcaactggctgatgctttggctcaactaagtatgcgagatgagcaacagcagaagtccaacccttttgctaaaaaggaccagggggcagacaataacagagtggagcaggagcttcgcaaagaggttgaagacctgaagctgagattgcagatggcagcggaccactataaagataaatttaaagaatgccagaagcttcagaagcaagtagtaaaactcacagagcagcttaaagctacagaaaatcagcagaaagaaagagaactgttttgtgctacagaggctgcagctgttacagttatgaagcaatgtactccaccagtgagtccgtttacttctgattctttacctgaatttgacattagagagcaagtgcgggaaatgagcttagaaatggctgaaaaaacagaaaaatatcgcaagtgtaagcaaatgctggctgaagaaaaagcaagatgcagtgcctatgctgatgatgttgccaagatggaactaaagtggaaggagcagctcaaagtcaacgacagcatcaagcggcaattgattgctttggatgatcaatataaagtgcagtctgcagagaaagatcgagaaatatgtgacctgtcttatagtattgaaacacttcgtaatgaaaaggcgaaaatggagagatttataaatgatcttgagaaaaaactggaaaaacaagcaggctgggctgcaagtaacacacaggggctgcagttctttaatccatattgtgatgaacacagattagctcctgccattccagctcagcagcctcttcttcagtttggaaatccatatgcatctcaagaaactagagatggagcagatggagcttttaatccagatgaagtccaaggacctccagtaagagctacctcctggggtctcgaggacaaggttgtctgcagtcaacctgctcgcaaccttagtcggcctgatggtttggaagatcctgatgaaaacaatgcaggcctaattactaaggatgaagacgatgatgatgatgacgataatgtaaattttgaacaaactcctgatcctacacgcatcgccatgcatgaccaatcaggcttctgctttgaagcagggtacactatgaataagaagtgccctctctgcccagtctcatttccccccaactacgaccagggccagtttgaagcccacgtggagagtcactggaaagtctgccccatgtgcaacgagcagttccccccagactgcgaccagcagatcttcgagcggcatgtgcagacccactttgatggcagtgtcttgaattttgactaaagccgccatgcttgttgtatgtttgtaatgtagcggtgaggagatcaccttaaaaactaggtgtgcaatgtagcttaaagcgtcactccccatcagaaccaatgggggcaataaatctgcttggaagtagggatctgtcattactttcccttaaacagactataacgtatgtggccatgggctgtcccttcatgatttcatattcctcagtatccgcacttgtctgaacccatccttagtcccctcattcagggcaagcaaaatggcagtttccattgatatatactttaatgaaagcagcatatggcttggttgctggtaatatgctgtaattatttgcacagacatttataatagattaaagtcaagtgaatccattattcttatacctatctgtttagcggagagtgggataacccacttatacacgagggggtgggaaacatttccctttagaaatgttctgcaatgatttaaacataatttcttgcttctcttacgatatgatagatttaacttagtgttaattgcagttaatcctttaaagacaagagaggccacggtgtaaagggcacaaaacccaaatgctaccagtggtagaagaagggcagttcagtgatggcatatgctagttagggagtaatcccattggtctgattgcagcatgtctatttatacttctgataaagtgttctgtggcgctgggaaaaatccacccattgctttctattcatctctaccctgaggtaatattacattaatagcttggttattacaggcgctgtgtgatacccggaggagcccgcacacaacactaaagggcatatttatcaagctgcgcaacagaagaagtggagttatgatgcactacacatagcgataagctgggaataagtgggaggcggagagtacaattctctgtggtggttccttgttttgtttaataatttaccttttagctcaggagaaattattgagcaaattcaggtggaatttatcaaggtgtagagtttgtttctgaagtaaaacattttatacagcttgataaataggcccctaaagctgaactattatttgcagagtgatgcaaagtcatttggttccagccgacataactggttattatgcagttgcctgcccaagcctattacatgcctggaataaatgcgctgtatgacatggcagtcagataatatcatttattttaagaaggttaaaggggacatatactatttaacctgtaacattgctcagaatgctcttttgagcacttttgtaatttacattttttaaaaagatttcatgatttacactgctaagaaatcggtgttgcctgagtgccccctgctttttggcttcagtgagggtcaagcaaaacagcaagagtttactgaagcataagcatctcttgacacttctctgctcacttctactgtcccctcatactgagcaatgggctgagccgcagagcagcaagagactcgtcctactcacagcaaggggaactttatcatatgagctactaatattgggaaaccttaaaaatattactgttaattccaaaaatgctttaaagagctttctaacaattttacattgtaaatggtcccctttacagaaatcataccatatttatgttttaactctttcttgtaatgtctgtataaagtctctttctgttcagcccaagcatcatttgcttgaacactattgttcttctgtttcaaataaagagaaatctgagtgcatctgtgtagcttggagtctccactgcagtctctcctgttatttctctcctcccatatctctctctgtatctcgctctcccccccccaactctttgcctttatctctccctcccatatctctctctgtatctcccaccccccatatctctccctgtatctctatctctccctgtatttctctctctccccccccaccatatctctttgccattatcattccctcccatatttctctctgtatctcccaccccccatatctctccctatatttctatttctctcttcctctctcttccccccccccccgtatctctttgcctttatctctccctcccatatctttctctgtatctcccaccccccatatctctccctgtatctctctatttctccctgtatttctatttctctctcttactctccccccgcccccccccccgtatctctttgcctttatctctccctcccatatctttctctgtatcttcccccctttgtatatgtctttcctgcatctctgcctttatctctccatgtttcataccccagtaacggctactttgcggaactatacaacttgtgtcacaaattgtgtttgattgaatgcagccgagtttaacctggatgtacgagtgcagcttctcctgtaaattaaatcattaaactttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSALQEIPSPISNMQTSNFAHVIFQNVAKSYLPNAPLECHYTLTQYIHPHPKDWVGIFKVGWSTPRDYFTFLWSLMPEKYVAESTCNCVLTFQGYYLPNDDGEFYQFCYVTHKGEIRGASTPFQFRASSPVDELLTMEDEGHSDMLVVTTKTGLLELKIEKTMKEKEELVKITTVLEKEVLQLREHVEGLESEFLREQKRSEQLSSEREELFNASEILRNESDEAKRKCKEMSAKIIQLEEDIMLVTQKAIAKETELDSLKDKLKKVVLEKDQLECQLKYEKDEKDLYKVHLKNTEIENTKLLTEVQTLKNLDTNKENLISHYKEELGKLQICLADKEKMNKELLQNSSNKEDIAFLKQQLRKLEDQHQASRQEVSLMSRELSEAVNKRDKTMADLHSARLDTDSVRMQLADALAQLSMRDEQQQKSNPFAKKDQGADNNRVEQELRKEVEDLKLRLQMAADHYKDKFKECQKLQKQVVKLTEQLKATENQQKERELFCATEAAAVTVMKQCTPPVSPFTSDSLPEFDIREQVREMSLEMAEKTEKYRKCKQMLAEEKARCSAYADDVAKMELKWKEQLKVNDSIKRQLIALDDQYKVQSAEKDREICDLSYSIETLRNEKAKMERFINDLEKKLEKQAGWAASNTQGLQFFNPYCDEHRLAPAIPAQQPLLQFGNPYASQETRDGADGAFNPDEVQGPPVRATSWGLEDKVVCSQPARNLSRPDGLEDPDENNAGLITKDEDDDDDDDNVNFEQTPDPTRIAMHDQSGFCFEAGYTMNKKCPLCPVSFPPNYDQGQFEAHVESHWKVCPMCNEQFPPDCDQQIFERHVQTHFDGSVLNFD
Donor tissue: tailbud