ORFeome > tbc1d15 – XORFeome 2.0

tbc1d15 – XORFeome 2.0

General Information

Species: Xenopus tropicalis TBC1 domain family, member 15, mRNA (cDNA clone MGC:76102 IMAGE:5308347), complete cds
Gene Symbol: tbc1d15
Gene ID: 394831
ORF gb_acc:
ORF ID: 10007

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063206

Library Location

Plate ID: GDExt11001
Well Location: E10

EST Sequences

Clone: MGC:76102 IMAGE:5308347
Trimmed Sequence: ATGGCGGCTCCTGGCCAAGGAAAGGTTCTTTATGATCAAGAAGGGGTATTCATACATTCATCTTGTGGAAAAATTGATGAGCAAGACACTTTAATCCCTGGAATATTACGTGTCATAGAAAAGGATGAGGACGTTGTAGTAGATTGGAGACCACTAGAAGAAACAATGGATTCCTCTAATATTCTTTGTGCTGCAAAGGATTCAAGCTCAGTTGTAGAGTGGACTACAAAGGAGAGGGGGATGCATTTACCAGATCACCAGAACAGTTATGAAGCAGAGTGGGATATGGTCAACACAGTTTCTTTTAAGAAAAAGCAATTTGCTAATGGAGGTGTTCAAAGTCCCCTAAATAGCCAGAGCAAATGGTCATTCCTCTTCAGCTTGGCAGACCTGAAGTCAATTAAACAGAACAAAGAAGGCATGGGCTGGTCTTATTTTGTTTTCTGCTTGAAGGATGATGTTGTCCTTCCAGCTCTTCATTTCCATCAAGGAGGAAGCGAACTTCTGCTTGAGTGCCTAGGGAAACATGTCATGTTTTGTGAATCTGAACAGGATGGCAGAATTCTTTTGGTCAGTTGTCAGAACAATAGTCTTTCTCAGTCTTTTGAAAATCTTCTGGAGGAGTCCACATATAGTTTAATTCAAAAATTAAAGAAAGACCCATATACTGCCACCTTGGCTAGCTTTTCCAAAGTTACAAACTATTTATTTGACACTATAAGAGGTTCTGATCCTGTTACTCAACGCAGGCCACGCGAGGAAATGGCGTTTTTGGGTGATGCAATCCAAGATCTAAAAATAAACCAGCAGGAGGAATCTGGATTTGAAGTGATAACTCGAATTGATGTTGGAACACGCCCAGAAGTTCATCGAAGGGATCCTATGTCAACAGCTGAATGGGAAGCCAATATAGACCATGAAGGAAGAATTTGTAATGTGGATCGCATTAAGAACATGATTTTTAAAGGGGGTCTTTGTCATGCCTTAAGGAAAGAGGTTTGGAAATTTCTTCTGGGCTACTTTCCATGGGATAGTACACGAGAGGAACGAGCTCATTTGCAAAAAAGAAAAACAGATGAATATTTTCGAATGAAACTTCAGTGGAAGTCGGTCAGTGAAGAACAAGAAAATCGAAATTCCAAACTCAGAGATTATAGAAGCTTAATAGAGAAAGATGTCAACCGCACGGATCGAACAAACAAGTTTTACGAGGGCCCAGATAATCCAGGATTAAATTTACTTCATGACATTTTAATGACATATTGTATGTATGATTTTGATCTCGGATATGTGCAAGGAATGAGTGACTTGCTTTCTCCTGTTCTGTATGTTATGGAAAATGAAGTAGATGCCTTTTGGTGCTTTGTATCATACATGGATCAAATGCATCAGAATTTTGAGGAGCAGATGCAGGGAATGAAGACGCAGCTAGTTCATCTGAGTACATTGCTGCGGTTACTGGACAGTGGTTTCTGCAGTTACCTTGAATCTCAGGACTCTGGATACTTATATTTCTGTTTCCGGTGGCTTCTTATCAGATTTAAAAGGGAATTTAATTTTCAAGATACTCTACGATTGTGGGAGGTAATATGGACAGATCTTCCTTGTCAGAATTTTCATCTGCTTATTTGCTGTGCTATCCTGGAATCAGAAAAACAAGTAATTATGGAGCAACATTTTGGATTTAATGAAATTCTTAAGCACATCAATGAACTTTCCATGAAGCTGGATGTTAACGATGTTCTAAGCAAAGCTGAAGCAATTTCTTTGCAGATGATGAAGTGCAAGGATTTACCACTGAATGTTTGTGATGTTATTGGCATAAAGAACAATGGTGTTGCAGGACCAAATGAAGCAACAAGTGAAGAAAATCTTGCCAAAAAACATAAAAAATCATCACCTCAATATGTCCCAGTGCCTGTAATTGCTGCCAATGGAACAAAAAGTGCTGCAACCCTACAAACTTTGCCAAACAGTGTTCACACACCAACTTCTGCCTGA
Full Trace Sequence: cactcgtaggcaagatggcggctcctggccaaggaaaggttctttatgatcaagaaggggtattcatacattcatcttgtggaaaaattgatgagcaagacactttaatccctggaatattacgtgtcatagaaaaggatgaggacgttgtagtagattggagaccactagaagaaacaatggattcctctaatattctttgtgctgcaaaggattcaagctcagttgtagagtggactacaaaggagagggggatgcatttaccagatcaccagaacagttatgaagcagagtgggatatggtcaacacagtttcttttaagaaaaagcaatttgctaatggaggtgttcaaagtcccctaaatagccagagcaaatggtcattcctcttcagcttggcagacctgaagtcaattaaacagaacaaagaaggcatgggctggtcttattttgttttctgcttgaaggatgatgttgtccttccagctcttcatttccatcaaggaggaagcgaacttctgcttgagtgcctagggaaacatgtcatgttttgtgaatctgaacaggatggcagaattcttttggtcagttgtcagaacaatagtctttctcagtcttttgaaaatcttctggaggagtccacatatagtttaattcaaaaattaaagaaagacccatatactgccaccttggctagcttttccaaagttacaaactatttatttgacactataagaggttctgatcctgttactcaacgcaggccacgcgaggaaatggcgtttttgggtgatgcaatccaagatctaaaaataaaccagcaggaggaatctggatttgaagtgataactcgaattgatgttggaacacgcccagaagttcatcgaagggatcctatgtcaacagctgaatgggaagccaatatagaccatgaaggaagaatttgtaatgtggatcgcattaagaacatgatttttaaagggggtctttgtcatgccttaaggaaagaggtttggaaatttcttctgggctactttccatgggatagtacacgagaggaacgagctcatttgcaaaaaagaaaaacagatgaatattttcgaatgaaacttcagtggaagtcggtcagtgaagaacaagaaaatcgaaattccaaactcagagattatagaagcttaatagagaaagatgtcaaccgcacggatcgaacaaacaagttttacgagggcccagataatccaggattaaatttacttcatgacattttaatgacatattgtatgtatgattttgatctcggatatgtgcaaggaatgagtgacttgctttctcctgttctgtatgttatggaaaatgaagtagatgccttttggtgctttgtatcatacatggatcaaatgcatcagaattttgaggagcagatgcagggaatgaagacgcagctagttcatctgagtacattgctgcggttactggacagtggtttctgcagttaccttgaatctcaggactctggatacttatatttctgtttccggtggcttcttatcagatttaaaagggaatttaattttcaagatactctacgattgtgggaggtaatatggacagatcttccttgtcagaattttcatctgcttatttgctgtgctatcctggaatcagaaaaacaagtaattatggagcaacattttggatttaatgaaattcttaagcacatcaatgaactttccatgaagctggatgttaacgatgttctaagcaaagctgaagcaatttctttgcagatgatgaagtgcaaggatttaccactgaatgtttgtgatgttattggcataaagaacaatggtgttgcaggaccaaatgaagcaacaagtgaagaaaatcttgccaaaaaacataaaaaatcatcacctcaatatgtcccagtgcctgtaattgctgccaatggaacaaaaagtgctgcaaccctacaaactttgccaaacagtgttcacacaccaacttctgcctgataacacaaattcctgtgaaccaagggggactcactgaagaaaactcacgtaagacgattttggagaatttcaaacatttttatctacagcagcaacttttcattagagcttttcaaaaggaaagatatgaacaaattatttttctagtggacacaaaccacctctattctgtttctgtcattccttaagcctgtcactgagaaagcaagtttacattgtaaactggaaaatatttatttttagtggcttacatgacagcaatgaaaataaagcaacttgaagatcatgtgttttatattcctaaaaaaagtacaacaaacagaagttttgtttataactgcgaattgtgtttccttactttgtagtaataacagattactgaaaattgtgtgcatttaaggaggactcaactacgttgttttttgtaatcacattttgcagtgttcaacagcgtctaatataatattccataggaaagtatctgaggattccagatataatgtatacaaataatacacgagcaattaaaatgcataaatctttctatacaagaatagttcagaaaagaccgggactctagtactttcctaattctacttaaggtttaataaggaatctgattactgagtttaactttcccttgccattcccaagtacatttatccttataaatgctttcatttaatgttaaagagataacgttgatatattttgagctaaatgttaatttaaacatttattgtaaccaaactgcatatgaatattactcctttcagttaatactcagcattgcaatattttcctatgttagtaaaaaaaaaacctaaaggaaataatttttattaagcaaagcattattttcattaaattatgctcccaaagctgcacatattgctgcagaatggtgtgaggacaatatgaaaacagattgttactttggtgttggaattggtttatattcacactggtgattcaatcagatgtatttaacagtctcaataaatcgtgcattttcagcttgagatgcatttagtgtcccgcatgatttttggttatgtgttttgaaaataaattgctaaatgtattaaatgtacagtaaatactgtaaataaataaatctgtaatgatttgtacagatatttaaataataaacaaaaaaaaaaaaaaaaaa
Translation: MAAPGQGKVLYDQEGVFIHSSCGKIDEQDTLIPGILRVIEKDEDVVVDWRPLEETMDSSNILCAAKDSSSVVEWTTKERGMHLPDHQNSYEAEWDMVNTVSFKKKQFANGGVQSPLNSQSKWSFLFSLADLKSIKQNKEGMGWSYFVFCLKDDVVLPALHFHQGGSELLLECLGKHVMFCESEQDGRILLVSCQNNSLSQSFENLLEESTYSLIQKLKKDPYTATLASFSKVTNYLFDTIRGSDPVTQRRPREEMAFLGDAIQDLKINQQEESGFEVITRIDVGTRPEVHRRDPMSTAEWEANIDHEGRICNVDRIKNMIFKGGLCHALRKEVWKFLLGYFPWDSTREERAHLQKRKTDEYFRMKLQWKSVSEEQENRNSKLRDYRSLIEKDVNRTDRTNKFYEGPDNPGLNLLHDILMTYCMYDFDLGYVQGMSDLLSPVLYVMENEVDAFWCFVSYMDQMHQNFEEQMQGMKTQLVHLSTLLRLLDSGFCSYLESQDSGYLYFCFRWLLIRFKREFNFQDTLRLWEVIWTDLPCQNFHLLICCAILESEKQVIMEQHFGFNEILKHINELSMKLDVNDVLSKAEAISLQMMKCKDLPLNVCDVIGIKNNGVAGPNEATSEENLAKKHKKSSPQYVPVPVIAANGTKSAATLQTLPNSVHTPTSA
Donor tissue: gastrula