ORFeome > tbx3 – XORFeome 2.0

tbx3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis T-box 3, mRNA (cDNA clone MGC:97730 IMAGE:6986826), complete cds
Gene Symbol: tbx3
Gene ID: 613116
ORF gb_acc: MG134501
ORF ID: 12213

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC099621

Library Location

Plate ID: GDExt11022
Well Location: B04

EST Sequences

Clone: MGC:97730 IMAGE:6986826
Trimmed Sequence: ATGAATTTACCCATGAGAGATCCAGTGATTTCAGGGTCAGCCATGGCTTACCATCCATTCCTATCCCACAGGGCACCAGACTTTGCAATGAGTGCTGTTCTTGGACACCAACCTCCCTTTTTTCCAGCTCTGGCTCTGCCACCCAATGGGGCTGCTCTTTCCCTTCCTGGTGCCCTGGCCAAGCCCATCATGGATCAATTAGTGGGTGCCGCAGAGACTGGCATCCCCTTTTCATCTTTGGGTCACCAGGCAGCTGCTCATTTGAGGCCTCTTAAAACCCTTGAACCAGAAGAAGAAGTTGAAGACGATCCAAAAGTCCACCTGGAAGGCAAGGATCTCTGGGAACAGTTCCACAAAAGGGGGACAGAGATGGTCATCACAAAATCTGGGAGGAGGATGTTTCCCCCATTTAAAGTGAGGTGCTCTGGTCTGGACAAGAAAGCCAAATACATTCTGCTGATGGACATTGTGGCTGCAGATGACTGCAGGTACAAGTTCCATAACTCCCGATGGATGGTGGCTGGAAAGGCCGACCCCGAAATGCCCAAACGAATGTACATCCACCCAGACAGCCCGGCCACTGGGGAGCAATGGATGTCCAAAGTAGTGACTTTTCATAAACTCAAACTGACCAATAATATCTCGGATAAACATGGATTTACTATTTTAAACTCCATGCACAAATACCAACCCAGGTTCCACATAGTGCGAGCTAATGACATTCTGAAATTACCCTACAGCACATTCAGAACTTATGTGTTTCCTGAGACAGAATTCATTGCAGTGACTGCATACCAGAATGATAAGATCACTCAATTAAAAATTGATAACAATCCCTTTGCCAAAGGCTTCCGTGACACTGGGAATGGCAGGAGAGAAAAGAGGAAACAGCTTGCACTGCAGTCCATGAGACCATACGATGATCACCAGAAGAAGGATAATGGGAGTTCGGACGAGTCCTCTAGTGAACAGACTGCCTATAAATGTTTTGCCCAGACCTCTTCCCCAACCGCACCTGCAGTGGGCACCTCATCCCTGAAAGGTGTGCCCCCCAGTGATGGGGAGAGTGACGAGGAGAGTAGGGATGAAGGAGGGCCGGACACAGGCGAATCCACCAAGATCTCCACTACAACCAGTGAGGACTGCAGGGAGTTGGCCAGCCCCCCGAGGGCCCCACACTCAGATCTGGGCAGCAGGAGTAGGGAGCAGAGCAGCAGGACAGGGAAAAGCTCCCCGGACTCCCGGCACAGCCCAGGCCACATCAGCTCCAGCAGCAGCGGCAGGATCCTGAGCATCGAGGAGCTAAAAAGCCCCGCTAGAGATTCCCATAAAGCAGAGGAGTCGCAGCGATCCAAGGAAGCATTCCCCCCTCTCACTGTGCAAACAGACAGTAGCGCCCACCTTCTCAGCCAGGGGCATCTGCAGAACCTCGGCTTCCCCCCAGGACTCACTGGGCAGCAGTTCTTTAACCCGCTGGGCGCTTCGCATCCTCTGCTCTTTCACCCAAGTCACTTTGCAATGGGAGGGGCTTTTTCCAGTATGGCTGCTGGCATGAACCCACTTCTGGCTTCAGTTTCAGGAGCATCATCTGGGGTGAACAGCATAGACTCTACCGTCATGGCATCTTCCTCTCAAGGGCTGGCAGGCTCTTCTGCACTGCCCTTCCATTTGCAGCAGCAAGTCCTGGCCTCCCAGGGCCTGGCGATGTCTCCGTTCGGAGGGCTTTTCTCCTACCCCTACACCTACATGGCCGCGGCAGCCGCAGCCTCCTCTGCTGTACACAGACACCCTTTCCTTAACGCCGTGCGGCCCAGGCTCAGGTACAGCCCCTACTCGTTCCCTATGCCCTTTGCAGAAGGCAGCAGCCTGCTCACCACCGCCCTGCACTCACTGGATGGCAAAGCGAGTCTACTCTCCAGTCCGGCTGCCACTGCTCTGGACACTGAACTGAGCAGCAGAACCCCCACACTCTCCTCTGGTTCAGTCTCTTTATCCCCAAAGCTGTGCCCAGAGAAGGAAGCGAGCAGTGAGCTCCAAAACATTCAGCGGCTGGTTAGTGGGCTGGATTCCAAGCAGGAGCGGTCAAGGAGCGGTTCCCCTGATTGA
Full Trace Sequence: gtctctttcctctgtcttttctctcccaccctctcctcttcctctgtaaccccatctccctctttctgctctctcttctgacactggcacattctccgggaagggaggctgctatttattaaaaaaaaggaggacaaagggaagcaatccatttgggggaacagcggaagcaccagagtgcagtacaaaatagacatctgcatcttcactcttaatccttacctggagctgtgacagccgctggggctgccggagaagttgctgcttgcccagagaacacggactgccccagtctctccgatcgccgcacaagtgaaactctcgcaggaggatagctgagcggggaattgcatttcttcctctctctattcgaattaaagcctgagaataacccggcagtctcttgtgtcaatgctgggttttgccacattaatgtgcccgtgaagatccctcacactggactgagccccgagctgtgagatccaaagggtgcaagtgaatgaatttacccatgagagatccagtgatttcagggtcagccatggcttaccatccattcctatcccacagggcaccagactttgcaatgagtgctgttcttggacaccaacctcccttttttccagctctggctctgccacccaatggggctgctctttcccttcctggtgccctggccaagcccatcatggatcaattagtgggtgccgcagagactggcatccccttttcatctttgggtcaccaggcagctgctcatttgaggcctcttaaaacccttgaaccagaagaagaagttgaagacgatccaaaagtccacctggaaggcaaggatctctgggaacagttccacaaaagggggacagagatggtcatcacaaaatctgggaggaggatgtttcccccatttaaagtgaggtgctctggtctggacaagaaagccaaatacattctgctgatggacattgtggctgcagatgactgcaggtacaagttccataactcccgatggatggtggctggaaaggccgaccccgaaatgcccaaacgaatgtacatccacccagacagcccggccactggggagcaatggatgtccaaagtagtgacttttcataaactcaaactgaccaataatatctcggataaacatggatttactattttaaactccatgcacaaataccaacccaggttccacatagtgcgagctaatgacattctgaaattaccctacagcacattcagaacttatgtgtttcctgagacagaattcattgcagtgactgcataccagaatgataagatcactcaattaaaaattgataacaatccctttgccaaaggcttccgtgacactgggaatggcaggagagaaaagaggaaacagcttgcactgcagtccatgagaccatacgatgatcaccagaagaaggataatgggagttcggacgagtcctctagtgaacagactgcctataaatgttttgcccagacctcttccccaaccgcacctgcagtgggcacctcatccctgaaaggtgtgccccccagtgatggggagagtgacgaggagagtagggatgaaggagggccggacacaggcgaatccaccaagatctccactacaaccagtgaggactgcagggagttggccagccccccgagggccccacactcagatctgggcagcaggagtagggagcagagcagcaggacagggaaaagctccccggactcccggcacagcccaggccacatcagctccagcagcagcggcaggatcctgagcatcgaggagctaaaaagccccgctagagattcccataaagcagaggagtcgcagcgatccaaggaagcattcccccctctcactgtgcaaacagacagtagcgcccaccttctcagccaggggcatctgcagaacctcggcttccccccaggactcactgggcagcagttctttaacccgctgggcgcttcgcatcctctgctctttcacccaagtcactttgcaatgggaggggctttttccagtatggctgctggcatgaacccacttctggcttcagtttcaggagcatcatctggggtgaacagcatagactctaccgtcatggcatcttcctctcaagggctggcaggctcttctgcactgcccttccatttgcagcagcaagtcctggcctcccagggcctggcgatgtctccgttcggagggcttttctcctacccctacacctacatggccgcggcagccgcagcctcctctgctgtacacagacaccctttccttaacgccgtgcggcccaggctcaggtacagcccctactcgttccctatgccctttgcagaaggcagcagcctgctcaccaccgccctgcactcactggatggcaaagcgagtctactctccagtccggctgccactgctctggacactgaactgagcagcagaacccccacactctcctctggttcagtctctttatccccaaagctgtgcccagagaaggaagcgagcagtgagctccaaaacattcagcggctggttagtgggctggattccaagcaggagcggtcaaggagcggttcccctgattgagcccaagaagcactaagcccagttctgaaggtctcattccagttccagactggcagtgcactttgtgttgggtacaggaaagcccctcctatccttgactttctgcaagcagggatctacaaaggtttttcatctactgcaaacttgggggagaagtttggaccctggcaagctgctataggatcatgtataccactagcactctacagcctcctaacgggcactgggaacaggtcaggggcctgcaagtgtacagcccatctatcttatcagtgccacactctgccgccccccccccccccccctactgctgctgaactaaactccatcccctcccccacacacgcaaaaaccctcccgggaattctgggagttgtagttaagcaacagctggatatggaaaggctgaggatctctggtgatataaaccatcatttccttgcataaggaataaaacttgagggtctgttagaaataaaacatttgattaagggcaagaaaagggacaataatgccttgcttgtgtacattaggggatgatatgtctttttcacaggcctgtgtttttaaagcaatgtactggcttctgcatgcaaactaatccttccctgttagctctgcaatgcctgggaaatatcatggcaccgacatggggctcccctctagcaaagcggctttataccaatcacatacaaacacgagaacacatttagttcatgggaaatctaaactcattattgactaaacagtcctcatgcaataacaagtttagagaatagggcaaaaaaaaaaaaaaagcgaaaagggaggatattattaaaaaaaagtatttatgtaattatttgatatcttatgtaaataaaacaaaaatactgaatattaaaatttaatttatttataatgtatatattcatgtaaataaggctcttatttttagtgtgtgttaaaccgatttggtgccaaaggggacggcagtgtattagtagtaaaccaggaggcacgcaatgggttaagctgtttcctttaccattagtgttattttcattgaactattaaaaaaacaaacaaaatttatatatatatatattttttttttgtttgttttttttttgtatttataaaaccatgagacaaataaaataaacatacaaactcacagtcttggcaggttgaacggggagagacacttttcccatccaatgccttgaagcagaatttgcccaagaactaacagtccgtttactcacaaatacctgcttgtttgatcccagagtctccatacaaatatctcagttctgcactgcgggtttcacaatgaaaacctactctgtttataaatacctctgtcttggttaaatctagttgttgttatctgcacagtttgactcctagctgtgtcagtaataatatatgaaggtctgaatatctatctctctatatatgatgtaatgaatgttcgatagaacgtttctccttgtatttttgtttgtttcaaaagtctccaagtttcaataaatttttttattgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNLPMRDPVISGSAMAYHPFLSHRAPDFAMSAVLGHQPPFFPALALPPNGAALSLPGALAKPIMDQLVGAAETGIPFSSLGHQAAAHLRPLKTLEPEEEVEDDPKVHLEGKDLWEQFHKRGTEMVITKSGRRMFPPFKVRCSGLDKKAKYILLMDIVAADDCRYKFHNSRWMVAGKADPEMPKRMYIHPDSPATGEQWMSKVVTFHKLKLTNNISDKHGFTILNSMHKYQPRFHIVRANDILKLPYSTFRTYVFPETEFIAVTAYQNDKITQLKIDNNPFAKGFRDTGNGRREKRKQLALQSMRPYDDHQKKDNGSSDESSSEQTAYKCFAQTSSPTAPAVGTSSLKGVPPSDGESDEESRDEGGPDTGESTKISTTTSEDCRELASPPRAPHSDLGSRSREQSSRTGKSSPDSRHSPGHISSSSSGRILSIEELKSPARDSHKAEESQRSKEAFPPLTVQTDSSAHLLSQGHLQNLGFPPGLTGQQFFNPLGASHPLLFHPSHFAMGGAFSSMAAGMNPLLASVSGASSGVNSIDSTVMASSSQGLAGSSALPFHLQQQVLASQGLAMSPFGGLFSYPYTYMAAAAAASSAVHRHPFLNAVRPRLRYSPYSFPMPFAEGSSLLTTALHSLDGKASLLSSPAATALDTELSSRTPTLSSGSVSLSPKLCPEKEASSELQNIQRLVSGLDSKQERSRSGSPD
Donor tissue: gastrula