ORFeome > tcf21 – XORFeome 2.0

tcf21 – XORFeome 2.0

General Information

Species: Xenopus tropicalis transcription factor 21, mRNA (cDNA clone MGC:181149 IMAGE:8902620), complete cds
Gene Symbol: tcf21
Gene ID: 100126209
ORF gb_acc: MG136671
ORF ID: 15142

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC153711

Library Location

Plate ID: GDExt11048
Well Location: C11

EST Sequences

Clone: MGC:181149 IMAGE:8902620
Trimmed Sequence: ATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGAGGTGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGA
Full Trace Sequence: caggcgtgtcccttccagtgggtgctaatcaaacacatcccctttctgttgtattcagtcacaccttggtcccacaagggaaggagcagcataacagatcatgtccaccggttctctcagtgatgtggaggacttccaagaggtggaaatgttggaatgtgatggcatcaaactggatcctaataaagaatttggcatatccaacgacagcaatgaggagagctcaacctgtgacaatggttcacccaaaaaaggcagaggaacatcaggcaagaggagaaaagcacccagcaaaaaaagtccactgggcaacattaaccaggagggcaagcaggtccagaggaatgcagccaatgccagggagagagccaggatgagggtgctcagcaaagccttttctaggctaaagaccactttgccttgggtgcctccagacaccaaactttccaagctggacactttgcgacttgcatctagttacatagctcacctgcgtcaaattctagccaatgacaaatatgaaaatggctacatccatccagttaacctgacttggccctttatggtggctggaaaacctgaaaatgacctcaaggaagtagtaagcaccagccgattgtgtggtcccacggcatcatgacacagccagtggccctggatgcaaagactctcacaagtgggagctccctgttttgcagagccagaacgaactgggatatgtcagccagagaaaagcgaccaaatgtacataggactcattttaagcaaagattccactctctctatttatctttctgcctccctttatttcattcccaggagccttgctggtccaagagctaccctgcaatttgtacagtatgttaataaatggggggacacaggcagctgggctttgacagtcatgccctggaagaactcttcttgcatatatatatacatatagatttatattaaaattataaatatatatttttttcagacaggtttagatatttctctgaataaatctttatatacataaaaaaaaaaaaaaa
Translation: MSTGSLSDVEDFQEVEMLECDGIKLDPNKEFGISNDSNEESSTCDNGSPKKGRGTSGKRRKAPSKKSPLGNINQEGKQVQRNAANARERARMRVLSKAFSRLKTTLPWVPPDTKLSKLDTLRLASSYIAHLRQILANDKYENGYIHPVNLTWPFMVAGKPENDLKEVVSTSRLCGPTAS
Donor tissue: spleen