ORFeome > tgif1 – XORFeome 2.0

tgif1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis TGFB-induced factor homeobox 1, mRNA (cDNA clone MGC:75852 IMAGE:5382716), complete cds
Gene Symbol: tgif1
Gene ID: 395014
ORF gb_acc: MG133043
ORF ID: 10444

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC064716

Library Location

Plate ID: GDExt11004
Well Location: A08

EST Sequences

Clone: MGC:75852 IMAGE:5382716
Trimmed Sequence: ATGAAAGCCAAGAAAGGCTTAGTTCCTCTATCAGGCAGTGAGACAGAGGATGACGATGGTATGGATATCCCACTGGATCTTTCTTCCACTGCTGGCTCAGGGAAGAGGAGGAGACGTGGAAACTTACCTAAGGAATCCGTGCAGATTCTGCGGGACTGGCTCTATGAACACCGCTATAATGCCTATCCCTCTGAGCAAGAGAAAGCACTGCTGTCCCGTCAGACGCATCTCTCCACACTACAGGTCTGCAATTGGTTCATCAACGCGCGCCGCAGGCTTTTGCCTGATATGCTAAGAAAAGACGGGAAGGACCCCAATCAGTTCACCATTTCTCGAAAGGGGGCCAAGATAAGCGACGTGATCCAGATGGATTCCCCGACAGGCACAAAGCCTTACATTCCCACTATAGACGAGAACTCCTTTCATTTCACTTCGTCAGGACCTAATCAGAGCTCAGGGAAGTTGCTGGCTTCTAAACTGTCTCCTCCACAATCTCTGCTCGCTCGCCCTTCTGTGATCTGTCATACCACTGTAACGTCACTAAGTGATGCGCCCTTCAATTTCACCCATGTGTTAAACGCTGGACAAATCCCAGACCCGCAGCAGACCGAAGCGAGCAACTTAACAGAAACCTCAATTCTGTACCATGAAGACACTAGTAAACTGGGACAAAACACAAATGCACAAAGTGGACTTTTCAACACTCCGCCCCCAACTCCCCCAGACCATAACCAGGATTTCAGTGGCTTTCAGTTATTGGTAGATGTTGCTCTCAAACAGGCTGCAGAGATGGAGCTGCAGGCTAAGCTTGTGGCCTAA
Full Trace Sequence: gagcgttacactacatctacctctggctttctttaaccttaaactgcctcattgtggcaccacacagaaaagttgaagggagacgggcagattggaacaagacccaggaggaggggggaaagtagaagaagataaaagcaaaaagaaagagcctgttggtgaagtgtaaaagtgaacaccaacacatacatacaaactgaagtcatttagttcggggcatcccgtgtgtgtacattggctcccggacttctctaacgttctgcctctgagctgggatcctccggcggccccacgctagtatgaaagccaagaaaggcttagttcctctatcaggcagtgagacagaggatgacgatggtatggatatcccactggatctttcttccactgctggctcagggaagaggaggagacgtggaaacttacctaaggaatccgtgcagattctgcgggactggctctatgaacaccgctataatgcctatccctctgagcaagagaaagcactgctgtcccgtcagacgcatctctccacactacaggtctgcaattggttcatcaacgcgcgccgcaggcttttgcctgatatgctaagaaaagacgggaaggaccccaatcagttcaccatttctcgaaagggggccaagataagcgacgtgatccagatggattccccgacaggcacaaagccttacattcccactatagacgagaactcctttcatttcacttcgtcaggacctaatcagagctcagggaagttgctggcttctaaactgtctcctccacaatctctgctcgctcgcccttctgtgatctgtcataccactgtaacgtcactaagtgatgcgcccttcaatttcacccatgtgttaaacgctggacaaatcccagacccgcagcagaccgaagcgagcaacttaacagaaacctcaattctgtaccatgaagacactagtaaactgggacaaaacacaaatgcacaaagtggacttttcaacactccgcccccaactcccccagaccataaccaggatttcagtggctttcagttattggtagatgttgctctcaaacaggctgcagagatggagctgcaggctaagcttgtggcctaactttggtttctttttcctttctcctaggagttaaaaactttcaaaacatttcttttggactgcccaggttgctaacagactctctgcattatctgaatctatatatttgtattttttctttttttttttttttttgcacatggaactgtcaagcggaacattcttatcacaaagaagtcttacctttttgaacttggactgctttgtgttccccttcataagaactgtgactcaagcgtttgactgttgagagattctcagttgccatgttatggacattgctttattgcaaagtggccattagcttattcttgcagtgatctagaacagggatgtctaacctgcatcccctccagttgctaaactacaaatacaagttgccacctgcggctagggggctgcaagcaggtcatccttgtgctagaagtactcaggggcgagggagatgatatatcatatacacactgcatttcattcagataaacctaaagttagagctactgtagaaacgacatgcttctattgtttcttggtagataaatgtgagttgtttcccaagattgtgactttttttggtacctttcagactgtgcaatatttagaaaacaaattagaactttttatatcattccagagcaggaaatatgctctcatactgtctacaactagaattttttttttttcccccacaatgtaataaaatgttttgtttaaggtaatatacaaactgtgtttttgttacctgggaatggcattagaatactatgtaactggattctgttcccacctggaatattaactgctatgtaaagatttgtttccaagacctgtattatttttgtatacttttgtaatatagaaaaataacaatgggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKAKKGLVPLSGSETEDDDGMDIPLDLSSTAGSGKRRRRGNLPKESVQILRDWLYEHRYNAYPSEQEKALLSRQTHLSTLQVCNWFINARRRLLPDMLRKDGKDPNQFTISRKGAKISDVIQMDSPTGTKPYIPTIDENSFHFTSSGPNQSSGKLLASKLSPPQSLLARPSVICHTTVTSLSDAPFNFTHVLNAGQIPDPQQTEASNLTETSILYHEDTSKLGQNTNAQSGLFNTPPPTPPDHNQDFSGFQLLVDVALKQAAEMELQAKLVA
Donor tissue: neurula