ORFeome > thap1 – XORFeome 2.0

thap1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis THAP domain containing, apoptosis associated protein 1, mRNA (cDNA clone MGC:89363 IMAGE:6988327), complete cds
Gene Symbol: thap1
Gene ID: 448407
ORF gb_acc: MG133885
ORF ID: 11471

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075499

Library Location

Plate ID: GDExt11015
Well Location: D01

EST Sequences

Clone: MGC:89363 IMAGE:6988327
Trimmed Sequence: ATGGTGCAATCGTGCTCGGCTTACGGTTGCAAGAATCGCTACGATAAGGATAAACCCATCTCTTTTCACAAGTTTCCCCTTAAACGCCCGCTACTCTGCAGGAAATGGGAAGCAGCTGTACGTAGAGCTGACTTTAAACCTACAAAGTACAGTAGCATTTGCTCTGACCATTTTACAGCTGATTGCTTCAAAAGAGAATGCAACAATAAGCTTCTTAAGGATAATGCTGTGCCAACAATATTTGCACATACAGAAATAAAGAAAAAGAGTGGAAAAGCTGTTAAAAAGGAGCAGCTGCCAGCTGAACCTGAACCAGTCCCGTCTGTTCCTGAAGTAGACCCTGCTATTGGATTGCTACTCCCTCCTCTGTATACACCAAGTCACATTGCAGTGATTTGTGACCACAATTATACAGTGGAAGATACTGTTCATCAGAGGAGAAGGATACAACAGCTTGAAGAGCAAGTTGATAAACTTAGGAAAAAGCTGAAGATAGCTAACCAGAAGTGTCGAAGGCAGGAACGTAGTTTGGAAAAACTGGAGAGAGAGGTTTCTGAATATAGGGAAGCCAAGGGATCTGGCTACGTTATCTTCCCTGGCAATTATTATGAAGTCTTAAATGAAAATGAATACAAAGAACTGGCTCCAGAAATAACATATAAAGAAATCATTCTGTAA
Full Trace Sequence: cgcaattcaccaacagtctctgcaaaattattgtaaattaattcggtggtgctgtcaactcggtagccagcgatacaccagatcgagaaattaaagcaatctacggaaaacccgtcgcgcttttcaaggtgcaataaggcggtaccgtctgtagcagaagaaactgggcgcgtcggaaaacatggtgcaatcgtgctcggcttacggttgcaagaatcgctacgataaggataaacccatctcttttcacaagtttccccttaaacgcccgctactctgcaggaaatgggaagcagctgtacgtagagctgactttaaacctacaaagtacagtagcatttgctctgaccattttacagctgattgcttcaaaagagaatgcaacaataagcttcttaaggataatgctgtgccaacaatatttgcacatacagaaataaagaaaaagagtggaaaagctgttaaaaaggagcagctgccagctgaacctgaaccagtcccgtctgttcctgaagtagaccctgctattggattgctactccctcctctgtatacaccaagtcacattgcagtgatttgtgaccacaattatacagtggaagatactgttcatcagaggagaaggatacaacagcttgaagagcaagttgataaacttaggaaaaagctgaagatagctaaccagaagtgtcgaaggcaggaacgtagtttggaaaaactggagagagaggtttctgaatatagggaagccaagggatctggctacgttatcttccctggcaattattatgaagtcttaaatgaaaatgaatacaaagaactggctccagaaataacatataaagaaatcattctgtaactttcctaccaatttgactttacagtaaactagtaaattccagaaacctatacagtacagagtgatttttttttactataattgctttgctaaaaatgttcttgcttattttaatacacatgcttataacaacccatgttttctattaactgtatcgttactttcaaagttttgagatcttgccaaaaaaaacattgagtacagaaatactaaaaaaaagggcggtttcttttcagttgcgagaatttgtttatgtatcttaaatctgatgttaatgtgttagatatcatttcaagttgctgctgtgatcatcacatcagtatatgtatataggctattacatgctttcagtttttataaatctgctattaacatgatttctgtaaggcaaagcaattgctagtatatgtctttgaaatttatttgccatgaaagcatccaacagcatttttgcatgccttatttttgctttagccagttataaaacaataaatctaataactgtcgaacaaaaaaaacaaaaaaaaaaaaaaaaaaaa
Translation: MVQSCSAYGCKNRYDKDKPISFHKFPLKRPLLCRKWEAAVRRADFKPTKYSSICSDHFTADCFKRECNNKLLKDNAVPTIFAHTEIKKKSGKAVKKEQLPAEPEPVPSVPEVDPAIGLLLPPLYTPSHIAVICDHNYTVEDTVHQRRRIQQLEEQVDKLRKKLKIANQKCRRQERSLEKLEREVSEYREAKGSGYVIFPGNYYEVLNENEYKELAPEITYKEIIL
Donor tissue: gastrula