ORFeome > trim2 – XORFeome 2.0

trim2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis tripartite motif-containing 2, mRNA (cDNA clone MGC:79572 IMAGE:6978769), complete cds
Gene Symbol: trim2
Gene ID: 448181
ORF gb_acc:
ORF ID: 11152

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075100

Library Location

Plate ID: GDExt11011
Well Location: C07

EST Sequences

Clone: MGC:79572 IMAGE:6978769
Trimmed Sequence: ATGGCCAGTGAAGGCTCCAATATTCCCAGTCCTGTGGTGCGTCAGATAGACAAGCAGTTTCTTATCTGCAGTATATGCCTCGACCGATATAAAAATCCAAAGGTACTTCCCTGTCTGCACACATTTTGTGAAAGGTGTTTGCAGAACTACATTCCAGCCCACAGCTTGACCCTTTCTTGCCCTGTCTGCCGCCAGACATCAATCTTGCCTGAGAAGGGTGTCTCTGCTCTACAGAATAACTTTTTCATTACTAACCTGATGGATGTGCTGCAGCGGAGCCCAGATAATGGCATTGAGGAATCCTCCATTCTGGAGACCGTGAGCGCTGTTGCGGCAGGAAAGCCATTGTCCTGTCCCAACCATGATGGAAATGTGATGGAATTTTACTGCCAATCATGTGAAACTGCTATGTGCCAAGATTGTACTGGAGGGGAACATGCTGAGCACCCTACTGTGCCACTTAAAGACGTGGTGGAACAACACAAAGCTGCACTACAGGCACAGCTGGATGCTGTCAAGAAAAGGTTACCTGAGATTGATTCTGCTCTTCAGTGTGTGTCTGAAATTGTAAATCAGTTAGCATCACAAAAGACTAGTATTGTTGAAGAAATACACTCAACCTTTGATGATCTGCAGAAAACCCTAAATGTGCGCAAAAGCGTCCTTCTCATGGAACTTGAAGTGAACTATGGTCTGAAACATAAAGTTCTCCAAGCACAGCTTGATACATTAATTGAAGGTCAGGAGAGTATTAAAAGTTGCACAACATTTACCGCACAGGCACTTAACCATGGAACAGAAACAGAGGTTTTGTTAGTAAAGAAACAGATGAGTGACAAACTGAATGAGTTGGCAGAACAGGATTTCCCATTACAACCACATGAGAATGACCAGCTGGACTTTATTGTGGAAACAGAGGGATTGAAAAAGTCCATTCACAACCTTGGAACTATCTTAACCACAAATGCTGTGGCCTCTGAAACAGTAGCCACTGGGGAAGGGTTGAGGCAAAGTGTGATTGGACAACCAATGTCAGTCACCATAACGACAAAAGACAAAGATGGAGAACTGTGCAAGACTGGAAGTGCTTACATTTCAGCAGAGCTATTCACACCGGATGGTAGTGTTACTGATGGTGAAGTAGTTGATAATAAAAATGGTACATATGAATTTTCATATACAATTCCAACAGAAGGTGATTTCACTCTTTCCCTAAGACTTTATGATCAACACATTAAGGGAAGCCCCTTTAAACTCAAAGTAGTTAAATCAGCAGATGTTTCACCCACAACAGAAGGAGTTAAAAGGAGGGTGAAATCACCTGGAAGCGGTCATGTCAAACAGAAAGCAGTAAAGAGGCCTGCCAGTATGTATAGCACAGGAAAACGGAAAGAAAATCCTATAGAAGATGACTTAATCTTCAGAGTTGGATCTCGTAAAGATGAAGATGTTCGTTCGCTTACAGGAACCAAGGGAAGAAATAAAGGTGAATTTACAAATCTTCAGGGGGTGGCAGCATCGACAAATGGAAAAATCCTTATAGCAGACAGTAACAACCAGTGTGTTCAGATATTTTCAAATGATGGACAGTTTAAAAGCCGCTTCGGTATTCGAGGCAGGTCCCCAGGTCAGCTACAGCGACCAACAGGAGTAGCTGTACATCCAAGTGGTGACATCATCATTGCAGACTATGATAACAAGTGGGTCAGCATCTTCTCAGCAGATGGCAAATTTAAGACCAAAATTGGATCGGGAAAACTTATGGGACCCAAAGGTGTTTCTGTTGATCGCAATGGCCACATCATTGTGGTGGACAACAAAGCCTGCTGTGTGTTTATTTTCCAGCCAAATGGAAAAATTGTAACCAGGTTTGGTAGCCGAGGAAATGGGGACAAACAGTTTGCAGGTACACTCGATGGTCCTCATTTTGCAGCTGTCAACAGTAATAATGAAATAATTGTGACGGACTTTCATAACCACTCAGTTAAGGTATTCAACCAAGACGGTGAGTTCATATTAAAGTTTGGCTCAAATGGAGAGGGCAATGGCCAGTTCAATGCTCCAACTGGAGTTGCAGTGGATTCCAATGGAAATATCATTGTAGCTGACTGGGGGAACAGCAGGATACAGGTTTTTGATGGAAGTGGGTCGTTTTTATCTTATATTAATACATCTGCTGACCCACTCTATGGGCCTCAGGGACTTTCCCTGACATCGGATGGTCATGTGGTTGTAGCAGACTCGGGAAACCATTGCTTCAAAGTTTATCGATACCTGCAGTAG
Full Trace Sequence: gtttttcacctctgtagctgatgagagagctgcagctgcctatctttttttctgctacgttttccctgtgcgtcactgctgtaccaggaatcaagcatcagccactgatacacggctgtttgagaatggctttcacatggaggactgcttgccctgcctctccctgcagtgtgcctggaaatctttactagcaaggatgatgcttttccctgtgggattttctgtctctcgttgctacaatagaatttcagcccagtatttttgctgactacatggaattgccaacgacaatggtgtgcaaggtggaagggagcttaacccacatgtcagtggtctaggatggccagtgaaggctccaatattcccagtcctgtggtgcgtcagatagacaagcagtttcttatctgcagtatatgcctcgaccgatataaaaatccaaaggtacttccctgtctgcacacattttgtgaaaggtgtttgcagaactacattccagcccacagcttgaccctttcttgccctgtctgccgccagacatcaatcttgcctgagaagggtgtctctgctctacagaataactttttcattactaacctgatggatgtgctgcagcggagcccagataatggcattgaggaatcctccattctggagaccgtgagcgctgttgcggcaggaaagccattgtcctgtcccaaccatgatggaaatgtgatggaattttactgccaatcatgtgaaactgctatgtgccaagattgtactggaggggaacatgctgagcaccctactgtgccacttaaagacgtggtggaacaacacaaagctgcactacaggcacagctggatgctgtcaagaaaaggttacctgagattgattctgctcttcagtgtgtgtctgaaattgtaaatcagttagcatcacaaaagactagtattgttgaagaaatacactcaacctttgatgatctgcagaaaaccctaaatgtgcgcaaaagcgtccttctcatggaacttgaagtgaactatggtctgaaacataaagttctccaagcacagcttgatacattaattgaaggtcaggagagtattaaaagttgcacaacatttaccgcacaggcacttaaccatggaacagaaacagaggttttgttagtaaagaaacagatgagtgacaaactgaatgagttggcagaacaggatttcccattacaaccacatgagaatgaccagctggactttattgtggaaacagagggattgaaaaagtccattcacaaccttggaactatcttaaccacaaatgctgtggcctctgaaacagtagccactggggaagggttgaggcaaagtgtgattggacaaccaatgtcagtcaccataacgacaaaagacaaagatggagaactgtgcaagactggaagtgcttacatttcagcagagctattcacaccggatggtagtgttactgatggtgaagtagttgataataaaaatggtacatatgaattttcatatacaattccaacagaaggtgatttcactctttccctaagactttatgatcaacacattaagggaagcccctttaaactcaaagtagttaaatcagcagatgtttcacccacaacagaaggagttaaaaggagggtgaaatcacctggaagcggtcatgtcaaacagaaagcagtaaagaggcctgccagtatgtatagcacaggaaaacggaaagaaaatcctatagaagatgacttaatcttcagagttggatctcgtaaagatgaagatgttcgttcgcttacaggaaccaagggaagaaataaaggtgaatttacaaatcttcagggggtggcagcatcgacaaatggaaaaatccttatagcagacagtaacaaccagtgtgttcagatattttcaaatgatggacagtttaaaagccgcttcggtattcgaggcaggtccccaggtcagctacagcgaccaacaggagtagctgtacatccaagtggtgacatcatcattgcagactatgataacaagtgggtcagcatcttctcagcagatggcaaatttaagaccaaaattggatcgggaaaacttatgggacccaaaggtgtttctgttgatcgcaatggccacatcattgtggtggacaacaaagcctgctgtgtgtttattttccagccaaatggaaaaattgtaaccaggtttggtagccgaggaaatggggacaaacagtttgcaggtacactcgatggtcctcattttgcagctgtcaacagtaataatgaaataattgtgacggactttcataaccactcagttaaggtattcaaccaagacggtgagttcatattaaagtttggctcaaatggagagggcaatggccagttcaatgctccaactggagttgcagtggattccaatggaaatatcattgtagctgactgggggaacagcaggatacaggtttttgatggaagtgggtcgtttttatcttatattaatacatctgctgacccactctatgggcctcagggactttccctgacatcggatggtcatgtggttgtagcagactcgggaaaccattgcttcaaagtttatcgatacctgcagtagctaaggggccatagctttatggtaaaactgcattgcatttgaaccagcaccttcatgcaagattgattgggaaaaaaatcatgcttcttaagaagtgaactccaaaagactttgattttatttaaccacgtttacggtctggtgatgacttgcttttgtttaaagtgtttcatcgctatgaattcaaagtgggcttgtaaacgtacaaggggatggcattaacatgttagaggaaccttaacacaaaaatgtaaatgactcatcttgtgcacttaggtcttagaccttttagaatatatactcatggaatggcgactccatatgcgagtttccaaataattattaaccagttgttatacatatctctccaatgctgaaatctgaaagtcttctaatccatgtatattggtagctgttgtgttataaagtagattgtacaactgtacattaatatagcattgcaaagaacagtgtaatcagtacaacatttttaagctgttgtcatgtttgtaattattacacaaatctaagcagccttataaggccatgtgcatttctatttattctgtgggaaactgatataatgagcatacattcagtacatattgtttcatttcatgcattctgacaatattatttttttataaaacagaaaaaatacaagtttcatattaaaacgtattcatagttttttttttttacttctaatttcccatgaggtcatgctttattaataacttactatagggaagcaaaaagggaatccgaacaatattgcatgctcccttcctaataagacatcttaacatataaacattgttcttaatataatgaaagcagaaagacaacgtaggctgccttgaaatggataaatagccatatgaaaattgggttgggtgagttgcatcttaatagcactttccaacaatttgagtacaacagtaattctgataatctgattgaaataatttgaatctgaaaaaatagaaattatcaaggtgggaggatcgtatctaaaattttttttccccctgtgcacaccttttgccttacatctttttggtagtgaaaagaaacataaaggtgaactggtaaatgtatggttttaggctatagaattgcctgaaatcagggaaaggtggatctgttgggaaaagctttgtctgttttaaagtaagattttgataaaataaacatttttcagttttttgaaggaacactggaatgatatgttttaatcatgtctttgaaattctgtaaatcgcatttgaccaataaatggcaaaataacgacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASEGSNIPSPVVRQIDKQFLICSICLDRYKNPKVLPCLHTFCERCLQNYIPAHSLTLSCPVCRQTSILPEKGVSALQNNFFITNLMDVLQRSPDNGIEESSILETVSAVAAGKPLSCPNHDGNVMEFYCQSCETAMCQDCTGGEHAEHPTVPLKDVVEQHKAALQAQLDAVKKRLPEIDSALQCVSEIVNQLASQKTSIVEEIHSTFDDLQKTLNVRKSVLLMELEVNYGLKHKVLQAQLDTLIEGQESIKSCTTFTAQALNHGTETEVLLVKKQMSDKLNELAEQDFPLQPHENDQLDFIVETEGLKKSIHNLGTILTTNAVASETVATGEGLRQSVIGQPMSVTITTKDKDGELCKTGSAYISAELFTPDGSVTDGEVVDNKNGTYEFSYTIPTEGDFTLSLRLYDQHIKGSPFKLKVVKSADVSPTTEGVKRRVKSPGSGHVKQKAVKRPASMYSTGKRKENPIEDDLIFRVGSRKDEDVRSLTGTKGRNKGEFTNLQGVAASTNGKILIADSNNQCVQIFSNDGQFKSRFGIRGRSPGQLQRPTGVAVHPSGDIIIADYDNKWVSIFSADGKFKTKIGSGKLMGPKGVSVDRNGHIIVVDNKACCVFIFQPNGKIVTRFGSRGNGDKQFAGTLDGPHFAAVNSNNEIIVTDFHNHSVKVFNQDGEFILKFGSNGEGNGQFNAPTGVAVDSNGNIIVADWGNSRIQVFDGSGSFLSYINTSADPLYGPQGLSLTSDGHVVVADSGNHCFKVYRYLQ
Donor tissue: tailbud