ORFeome > tspan7 – XORFeome 2.0

tspan7 – XORFeome 2.0

General Information

Species: Xenopus tropicalis tetraspanin 7, mRNA (cDNA clone MGC:76243 IMAGE:5378962), complete cds
Gene Symbol: tspan7
Gene ID: 394976
ORF gb_acc: MG132766
ORF ID: 10070

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064249

Library Location

Plate ID: GDExt11002
Well Location: D01

EST Sequences

Clone: MGC:76243 IMAGE:5378962
Trimmed Sequence: ATGGCATCAAGGAGAATGGAGACCAAGCCAGTTATAACGTGTCTGAAGACGCTGCTTATTATCTACTCTTTCGTCTTCTGGATCACAGGAGTTATCCTTCTAGCAGTAGGTGTTTGGGGAAAGCTCACTTTAGGCACCTACATCTCTCTCATTGCTGAAAACTCTACAAATGCCCCCTATGTCCTTATTGGAACTGGAACAACAATCATTGTCTTTGGCCTTTTCGGGTGCTTTGCTACCTGTCGTGGGAGCCCATGGATGCTAAAACTGTATGCTATGTTTTTATCCCTGGTGTTCTTGGCTGAATTGATTGCTGGCATATCTGGATTTGTGTTTCGCCATGAGATCAAGGACACTTTCCTGCGGACATATACTGAAGCCATACAGAACTACAATGGCAATGATGAAAGGAGTCAAGCTGTTGATGATGTGCAGCGCAGTTTGAGGTGCTGCGGGGTGCAGTATTATACAAACTGGACCACCAGCCTGTACTGGCATGACCATGGTTTCCCATCCAGCTGCTGTGCCAATACTAGTGATTGCAATCCACAAGATCTGCGCAACATGACTATCAATTTCACTAAAGTGAACCAGAGGGGATGCTATGAATTAGTGACAAGCTTTATGGAGACTAACATGGGCATTATAGCTGGTGTGGCTTTTGGAATAGCATTCTCACAGCTGATTGGAATGTTGTTGGCTTGCTGTCTTTCTCGGTTTATAACTGCAAATCAGTATGAGATGGTGTAA
Full Trace Sequence: gtgagcggcaacagtaacacccggctaccggatctcagtagcatggcatcaaggagaatggagaccaagccagttataacgtgtctgaagacgctgcttattatctactctttcgtcttctggatcacaggagttatccttctagcagtaggtgtttggggaaagctcactttaggcacctacatctctctcattgctgaaaactctacaaatgccccctatgtccttattggaactggaacaacaatcattgtctttggccttttcgggtgctttgctacctgtcgtgggagcccatggatgctaaaactgtatgctatgtttttatccctggtgttcttggctgaattgattgctggcatatctggatttgtgtttcgccatgagatcaaggacactttcctgcggacatatactgaagccatacagaactacaatggcaatgatgaaaggagtcaagctgttgatgatgtgcagcgcagtttgaggtgctgcggggtgcagtattatacaaactggaccaccagcctgtactggcatgaccatggtttcccatccagctgctgtgccaatactagtgattgcaatccacaagatctgcgcaacatgactatcaatttcactaaagtgaaccagaggggatgctatgaattagtgacaagctttatggagactaacatgggcattatagctggtgtggcttttggaatagcattctcacagctgattggaatgttgttggcttgctgtctttctcggtttataactgcaaatcagtatgagatggtgtaacaaggtggcgctagtttacagagcgcaataaaggaatcaaacagaggatcattgaagaatgttagagaactcattcacctagcactctgtgttccctactatataccattttgtagtgtatccatccactgacacaactgtgccatgacaagtagcctacgtagtgtctaaccacacacttcctcatggaaggcttttcgtatgatggcactggacgtgtgttcttattcataaagttttagtatttgataattcattaactgcctcgacttggctgtgcatgcagtggctgcaaaaaagggacaaacactcccttaccaatggtttattaaatgtcccacacatttatataaatccatacatgaggaaacaaatatattgaattttttatatacatatatttatttacaaggcgtacttaacattttctttctttaccacttgcggttttcatgtaagaagaaaaaaaatctgtgatacgacaatacttgaagagtaatgttctaaatatgttgtgcttttcacaggatccatgctgctcatattagactgcagcatggacgctcctcctgtgccatttgcctattgcttctatcattgtctagtagtggatttggcatcagaatcagaacctgtgtttcactgttacagaactgttgttgcttgctgtgcggccagtgtaataatgcttctttttaatccttagtgtacaactaatctgaattgtgctgtaatgctacttctttttgtctatgttcctttctctcccctttctttgctttggaagtgcaacaaccaaataatactttgagataagtgtgaaaccagtataggtaaggacagaaggctgaaagactgaaaactttttaaagacaaagaaaactgatttttttttttatataatgtctccacctagcatgctgggaaaaaaacaatgctttgatattgtgagcatttgtgaaatatatattaataaactgaactatgaccgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASRRMETKPVITCLKTLLIIYSFVFWITGVILLAVGVWGKLTLGTYISLIAENSTNAPYVLIGTGTTIIVFGLFGCFATCRGSPWMLKLYAMFLSLVFLAELIAGISGFVFRHEIKDTFLRTYTEAIQNYNGNDERSQAVDDVQRSLRCCGVQYYTNWTTSLYWHDHGFPSSCCANTSDCNPQDLRNMTINFTKVNQRGCYELVTSFMETNMGIIAGVAFGIAFSQLIGMLLACCLSRFITANQYEMV
Donor tissue: tailbud