ORFeome > vdac1 – XORFeome 2.0

vdac1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis voltage-dependent anion channel 1, mRNA (cDNA clone MGC:146988 IMAGE:7883008), complete cds
Gene Symbol: vdac1
Gene ID: 549246
ORF gb_acc: MG136550
ORF ID: 15004

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC127348

Library Location

Plate ID: GDExt11047
Well Location: C05

EST Sequences

Clone: MGC:146988 IMAGE:7883008
Trimmed Sequence: ATGGCCATACCTCCGGCATATGCTGATTTAGGAAAGTCTGCCCGAGACATCTTCACTAAAGGATATGGATTTGGGTTCATTAAACTTGATTTGAAAACGAAATCAGAAAACGGACTGGAATTTACAAGCTCAGGATCAGCGAATGCAGAGACTAACAAAGTTGCTGGCAGCTTGGAAACCAAATACAAATGGGCAGAATATGGCCTTACTTTCACAGAAAAGTGGAATACAGATAACACATTAGGGACAGAGATCACTGTAGAAGACCAGCTTGCAAAGGGTCTGAAGCTGACATTTGACTCTTCATTTTCTCCTAACACAGGAAAGAAGAATGCAAAAGTCAAGACTGCATACAAGCGAGAGCACCTTAACATTGGCTGTGACATGGATTTCGATATTGCTGGCCCATCAGTGCGGGGAGCTGCAGTGTTTGGCTATGAGGGATGGTTAGCTGGCTACCAAATGACTTTCGAATCCTCAAAGTCCAGAGTCTCCCAAAGCAACTTTGCAGTTGGATACAAAACTGATGAATTTCAGTTGCATACCAATGTAAATGACGGTACAGAGTTTGGTGGTTCTGTATATCAGAAGGTTAATGATAAACTGGAAACTGCAATCAACCTTGCATGGACAGCAGGAAACAGCAATACACGCTTCGGAATAGCAGCCAAATATCAAATCGATAGTGATGCTTCGTTTTCAGCTAAAGTGAATAATTCAAGTCTTATTGGTTTAGGATACACTCAGACTCTTAAGCCTGGTATCAAATTAACGTTATCCACATTGCTCGATGGCAAGAACATAAATGCCGGAGGTCACAAACTGGGTCTAGGACTGGAATTTGAAGCATAA
Full Trace Sequence: ctcagctaggaagaaaatggccatacctccggcatatgctgatttaggaaagtctgcccgagacatcttcactaaaggatatggatttgggttcattaaacttgatttgaaaacgaaatcagaaaacggactggaatttacaagctcaggatcagcgaatgcagagactaacaaagttgctggcagcttggaaaccaaatacaaatgggcagaatatggccttactttcacagaaaagtggaatacagataacacattagggacagagatcactgtagaagaccagcttgcaaagggtctgaagctgacatttgactcttcattttctcctaacacaggaaagaagaatgcaaaagtcaagactgcatacaagcgagagcaccttaacattggctgtgacatggatttcgatattgctggcccatcagtgcggggagctgcagtgtttggctatgagggatggttagctggctaccaaatgactttcgaatcctcaaagtccagagtctcccaaagcaactttgcagttggatacaaaactgatgaatttcagttgcataccaatgtaaatgacggtacagagtttggtggttctgtatatcagaaggttaatgataaactggaaactgcaatcaaccttgcatggacagcaggaaacagcaatacacgcttcggaatagcagccaaatatcaaatcgatagtgatgcttcgttttcagctaaagtgaataattcaagtcttattggtttaggatacactcagactcttaagcctggtatcaaattaacgttatccacattgctcgatggcaagaacataaatgccggaggtcacaaactgggtctaggactggaatttgaagcataaagatgtcctatagaacaattgcattgtcccgatgttctgcaacatagaaaccataaaattttagtgcaccttgtatgttctgtgtctggtatgcaaacaacccactatgtcgattactattgattccctggaaaaacaaacacaagtgtgtgtgacagagttattgctgctgtgagaaatggtgagagaaactctagggtacagattttacaaatccaggccagcctggaaatacttcatagctgcttatttatacacgtgttgctaaacaacagagtattaaaggccttttttttaataacctatagagcagaatttattgacactactaacggacttttagatgaaacaaacaattcctttagtaagaattcattgttcggaactaggaagttacggtcctgcatcaacatcacgggtgcaggatcagagttttgtcatatgcacaacgtgtatatttagcacttgaacaaagcagggacttaaagtgaactatttcatacactgttaaaagtcttattaaaaatgtgtttattataaatatctgtagcccataagaagatatcccatattatcggtgcacacaaagaacgagccagtgacaatacttgattcccttcccataaagagtactggacagcttgacagagccatatgcaagggaagaatcttttattctttatacacatacttacatgtttgattggtttttaccctaccccagttttattttcattttttagaaaatgtagtgtcttccattctgtagatccctgatactgttcacaacatcacctgtaataaagtccgagtacaagaaaaaaaaaaaaaaaaaa
Translation: MAIPPAYADLGKSARDIFTKGYGFGFIKLDLKTKSENGLEFTSSGSANAETNKVAGSLETKYKWAEYGLTFTEKWNTDNTLGTEITVEDQLAKGLKLTFDSSFSPNTGKKNAKVKTAYKREHLNIGCDMDFDIAGPSVRGAAVFGYEGWLAGYQMTFESSKSRVSQSNFAVGYKTDEFQLHTNVNDGTEFGGSVYQKVNDKLETAINLAWTAGNSNTRFGIAAKYQIDSDASFSAKVNNSSLIGLGYTQTLKPGIKLTLSTLLDGKNINAGGHKLGLGLEFEA
Donor tissue: spleen