ORFeome > yif1b – XORFeome 2.0

yif1b – XORFeome 2.0

General Information

Species: Xenopus tropicalis Yip1 interacting factor homolog B, mRNA (cDNA clone MGC:76182 IMAGE:5335778), complete cds
Gene Symbol: yif1b
Gene ID: 394896
ORF gb_acc: MG132695
ORF ID: 9986

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064233

Library Location

Plate ID: GDExt11001
Well Location: A02

EST Sequences

Clone: MGC:76182 IMAGE:5335778
Trimmed Sequence: ATGAACCAGGAGAGCAGCTTCAGAGCCCCCCCCAAAAGACGCGTTCGGGGCCCCAACCCAAACATATCGACCCCCCACCAGCTGTTTGATGACACAAGTGGAGGGCCTGTTCCTCATGGAGGAGAGTATCCAAACCATTCATCACCAGCTTTGGGCATCCCAGCACAAGCCTTTTTGTCAGAACCCATGTCCAACTTTGCTATGGCCTATGGCAGCAGCTTGGCCAGTCAGGGAAAGGAGATGATGGACAAGAATATCGACCGGATTATTCCAGTTAGCAAAATCAAATATTATTTTGCAGTCGACACAGTCTATGTGGGTAAAAAGATCGGGCTGCTTATGTTTCCCTACATGCACCAGGATTGGGAAGTGAGATACCAACAGGACACCCCAGTGGCCCCAAGATTTGACATTAATGCTCCAGATTTGTACATTCCAGTCATGGCTTTTATCACATATATTCTGGTGGCTGGCTTGGCACTGGGAACACAGAGCAGGTTCTCACCAGAGATCCTGGGAATGCAGGCCAGTTCAGCCCTTGCTTGGCTTATTGTAGAGGTGCTTGCAATCCTCCTCAGCCTTTACCTAGTGACTGTAAATACAGATCTTACCACAGTGGATCTTGTAGCTTTTTCCGGATATAAATATGTGGGGATGATTTCAGGAGTTATTTCTGGCCTTCTCTTTGGAAAAACTGGTTACTACGTAGTACTCTCCTGGTGCGGTATCTCTGTAGTTTTTTTCATGATCCGCACCCTTCGTTTGAAGATCCTCTCTGAGGCTGCAGCTGAAGGTGTTTTGGTTCGTGGAGCCAGAAACCAGCTGCGTATGTACCTTACAATGGCTATTGCTGCTGTGCAGCCCATCTTCATGTACTGGCTGACCTACCACCTGGTGAGATGA
Full Trace Sequence: catgaaccaggagagcagcttcagagccccccccaaaagacgcgttcggggccccaacccaaacatatcgaccccccaccagctgtttgatgacacaagtggagggcctgttcctcatggaggagagtatccaaaccattcatcaccagctttgggcatcccagcacaagcctttttgtcagaacccatgtccaactttgctatggcctatggcagcagcttggccagtcagggaaaggagatgatggacaagaatatcgaccggattattccagttagcaaaatcaaatattattttgcagtcgacacagtctatgtgggtaaaaagatcgggctgcttatgtttccctacatgcaccaggattgggaagtgagataccaacaggacaccccagtggccccaagatttgacattaatgctccagatttgtacattccagtcatggcttttatcacatatattctggtggctggcttggcactgggaacacagagcaggttctcaccagagatcctgggaatgcaggccagttcagcccttgcttggcttattgtagaggtgcttgcaatcctcctcagcctttacctagtgactgtaaatacagatcttaccacagtggatcttgtagctttttccggatataaatatgtggggatgatttcaggagttatttctggccttctctttggaaaaactggttactacgtagtactctcctggtgcggtatctctgtagtttttttcatgatccgcacccttcgtttgaagatcctctctgaggctgcagctgaaggtgttttggttcgtggagccagaaaccagctgcgtatgtaccttacaatggctattgctgctgtgcagcccatcttcatgtactggctgacctaccacctggtgagatgatgccttacctgcctggatcaaaatggcctttgtcacccaggtcctgctatgatgtttatgataatatatgttttacattaagagccacagatgctgtaccaattgtaaacaagaacaagattcttctacacaaacaacactgactggtaccacacaaaggttttgccagaccaccagctgcaagatatcaaagtcccaatattatttccctcaattcaacagcatataaaatgactacagttatttcctttaaagaaccttttctcattttttttttgctactctggtgattaaaacaagtatcacctggaactatcagaatcctcaaggtttaaatatgtgttttgttttcatgcactaaaagaaaaatatctctatttattgtagtagtggagaaaaccaacatatttatcattttggatagaactttgaaatggacagtcacacacatgtacatgtgagaccagtctttatggagtatgggcctacatcaaacttccttccttaccttcaggcaaggaaggaagggaaatatgttctattcaaaacctaaaggatattttccatgcttcattattaaagtaagcagtttgtttttaaccattacaattggatgatttatctaatttcttagcagacttattgtaggtccttagcatataaaatttgaaattcaccatcactggtcattgaatgtccactcacacatctgaagcaccagttcttaaacatcaccccacctgcacatatccagtgctgttttccacatctagtgtgcagtttgtttccccttcctgcatatggcttggaatagaccattcccattatggttactcttcttttttttggaatgtattatgaagtgttttcggcttaatatagtgaggctgtggatgggtatcttcacctgaattttctaatatatttggttttatcaaaaacaatgctgaaatacaagtgttaatgctagaatcctgcagtatttaccagcatacaatacaaagagactgcatcaaaaaggaattaaattaacctcttatgatgtttgtgttaatgggtgaaattccaatattttggccttaatatttttgttttcaaaaattcttgtaatgtaggtttagatatgcatgacattttacattttgtgttaagatattctgtatcatgcctccgctttaaattaaaacattttgtcttgataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNQESSFRAPPKRRVRGPNPNISTPHQLFDDTSGGPVPHGGEYPNHSSPALGIPAQAFLSEPMSNFAMAYGSSLASQGKEMMDKNIDRIIPVSKIKYYFAVDTVYVGKKIGLLMFPYMHQDWEVRYQQDTPVAPRFDINAPDLYIPVMAFITYILVAGLALGTQSRFSPEILGMQASSALAWLIVEVLAILLSLYLVTVNTDLTTVDLVAFSGYKYVGMISGVISGLLFGKTGYYVVLSWCGISVVFFMIRTLRLKILSEAAAEGVLVRGARNQLRMYLTMAIAAVQPIFMYWLTYHLVR
Donor tissue: tailbud