ORFeome > ypel5 – XORFeome 2.0

ypel5 – XORFeome 2.0

General Information

Species: Xenopus tropicalis yippee-like 5, mRNA (cDNA clone MGC:89077 IMAGE:7005972), complete cds
Gene Symbol: ypel5
Gene ID: 493540
ORF gb_acc: MG134101
ORF ID: 11725

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082497

Library Location

Plate ID: GDExt11016
Well Location: C12

EST Sequences

Clone: MGC:89077 IMAGE:7005972
Trimmed Sequence: ATGGGCCGGATCTTCCTGGATCACATCGGGGGCACCCGTCTGTTCTCCTGCGCCAACTGCGATACCATCCTGACCAACCGCTCCGAGCTCATCTCCACCCGCTTTACAGGGGCCACAGGGAGAGCGTTTCTGTTCAACAAGGTGGTGAACCTACAATACAGCGAAGTCCAGGACCGCGTCATGCTCACCGGGCGCCACATGGTCCGAGACGTCAGCTGCAAGAACTGCAACAGCAAACTGGGCTGGATCTACGAGTTCGCCACGGAGGACAGTCAGCGCTACAAGGAGGGGCGGGTCATCCTGGAGCGGGCGCTGGTACGCGAGAGCGAGGGCTTCGAGGAGCACGTGCCGTCCGACAACTCCTGA
Full Trace Sequence: gtttgtgtgtgaggatcggggatcggggagcggcggcggcggagggagtccggggctgggaccggtaggagctgctgtaaagaagcggtctgtgcttgggaggaggaattgagcgatccccgctgtcccaccgaccccccagtctgagtgcggcctgactgctacgaagtgaaataataaagggaaaggatgggccggatcttcctggatcacatcgggggcacccgtctgttctcctgcgccaactgcgataccatcctgaccaaccgctccgagctcatctccacccgctttacaggggccacagggagagcgtttctgttcaacaaggtggtgaacctacaatacagcgaagtccaggaccgcgtcatgctcaccgggcgccacatggtccgagacgtcagctgcaagaactgcaacagcaaactgggctggatctacgagttcgccacggaggacagtcagcgctacaaggaggggcgggtcatcctggagcgggcgctggtacgcgagagcgagggcttcgaggagcacgtgccgtccgacaactcctgaaatgccgccggccccctttgccccgccctctgcgggtccatttagcgccaacagcacccattctcctctgtacatgcatacactgttaccgtagccgcagagatgcgccgcgcccaaccgacggcagcaacacctgaaagggatcattttgttacacttaccccccctccctttatatttgccccttgagaaaatccccttttcatggatcaaacttcaaattaaaggggaagtaaaggtgtttatttagaattttttccccatagtttcctttttctttgtagaagtgactcctccctcccatgattccctttctatagcgaatctctgtacagaagtcctagcggttcagtgtcggcccggcttgcgttggccgcgggggtttcgtcgggagtcagatgactgtttttgttttttttttttcgtttttctggcccaaagagaccgccgcattaagatctcgtgatgtttatagtgtgttcaggtggtgtggattcaacttaaaaaaaaaaaaaagaaaatgttaaaaaaaaaaaatgttaaaaaatatatattttgaaatgccgcaagaaaagtgttttatgtaaaagatccagcgcatcattagtacaataaaggaataagttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGRIFLDHIGGTRLFSCANCDTILTNRSELISTRFTGATGRAFLFNKVVNLQYSEVQDRVMLTGRHMVRDVSCKNCNSKLGWIYEFATEDSQRYKEGRVILERALVRESEGFEEHVPSDNS
Donor tissue: