ORFeome > znf821 – XORFeome 2.0

znf821 – XORFeome 2.0

General Information

Species: Xenopus tropicalis zinc finger protein 821, mRNA (cDNA clone MGC:97539 IMAGE:5383612), complete cds
Gene Symbol: znf821
Gene ID: 496803
ORF gb_acc: MG134471
ORF ID: 12177

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088490

Library Location

Plate ID: GDExt11021
Well Location: C05

EST Sequences

Clone: MGC:97539 IMAGE:5383612
Trimmed Sequence: ATGTCCCGAAGGAAACAAACAACTCCAAATAAAGTACATTGGGAACAAGTGTTTGCAGGTTTGAAGCAACAGGCCCGTGAAGCTATGATGAAAACAGACATTGTGAAACAAGAATTCTCTGTCTTTGGTCAGCACGAGAGGAGTAGCAGTGATAGTGAAGCAGAGGATACCACTATTGATGAGCTGTCCTCCCCCACCTCAGAGGAAGACAACTTGGAGAGAGAAGTAAAGGAGGAGCCTGGAGTCAGCAGAACTAGCAGAGAAAATGAACTTTCTGGGGAAATGGTTTCTGGAGCCGCTCATGATTCTGAACTATTTATTTGCCCATTATGCCAGCTGGCTTGTGAAACCCAGGAACAGCTAATCACTCATGTATACCAGCATACAGCTGCAGTTGTCAGTGCTAAGAGCTATCTGTGTCCTGTGTGTGGGCGAGCCCTCAGCTCTCCGGGGTCATTGGGACGGCACCTGTTGATACATTCAGAAGATCAGCTTTCCAACTGTGCTTTATGTGGGGCACAGTTCTCAAGTCATGCTACCTTCAACAGTGAGAAGTTGCCAGAGGTTTTGTCACCAGATACTTGGAACCAGAATAATCACAAAGGCTCCAGCAGTTGTGAGGGTAAGAACCCAGAGACTAGTGCAGTTTATCCTGCTGGCATCCTACTTGTTTGCAACAATTGCACAGCCTATAGGAAACTGATGACTGACCAGACACCTACAGTCCGTAAATGGGCTGCACGCAGACAGAATGAGCCTGCTGCGGCAAGAGTGCAGAGACTGGAGAGAGAGCGCACAGCGAAGAAAAGCAGACGTGATTGTGAGACCCCAGAAGAGCGTGAGATGCGTAGGATGAGGGACAGAGAGGCAAAAAGGCAGCAACGGATGCAGGAAACTGATGAGCAGAGGGCAAAGCGTTTGCAGCGGGATCGTGAGGCCATGCGTTTGAAACGAGCCAATGAGACACCAGAGAAACGCCAGGCAAGATTAATTAGAGAACGAGAAGCCAAGCGGTTGAAAAGAAGATTAGAAAAAATGGACATGATGTTGCGAGCACAGTTTGGGCAGGACCCTGCTGCTATGGTAGCTTTAGCAGAAATGAACTTTTTTCAGCTTCCTGTAGGGAATTCTGACCTAGAACAACAATTGCTAGGGAAGATGGAGCTTGAAGGTCAAAATAATGGTACTCTACCTTGA
Full Trace Sequence: tcttgctgtaaagtgtgtctgtgtgggtgtcagtcaggtcccaggaggacagaagatgtcccgaaggaaacaaacaactccaaataaagtacattgggaacaagtgtttgcaggtttgaagcaacaggcccgtgaagctatgatgaaaacagacattgtgaaacaagaattctctgtctttggtcagcacgagaggagtagcagtgatagtgaagcagaggataccactattgatgagctgtcctcccccacctcagaggaagacaacttggagagagaagtaaaggaggagcctggagtcagcagaactagcagagaaaatgaactttctggggaaatggtttctggagccgctcatgattctgaactatttatttgcccattatgccagctggcttgtgaaacccaggaacagctaatcactcatgtataccagcatacagctgcagttgtcagtgctaagagctatctgtgtcctgtgtgtgggcgagccctcagctctccggggtcattgggacggcacctgttgatacattcagaagatcagctttccaactgtgctttatgtggggcacagttctcaagtcatgctaccttcaacagtgagaagttgccagaggttttgtcaccagatacttggaaccagaataatcacaaaggctccagcagttgtgagggtaagaacccagagactagtgcagtttatcctgctggcatcctacttgtttgcaacaattgcacagcctataggaaactgatgactgaccagacacctacagtccgtaaatgggctgcacgcagacagaatgagcctgctgcggcaagagtgcagagactggagagagagcgcacagcgaagaaaagcagacgtgattgtgagaccccagaagagcgtgagatgcgtaggatgagggacagagaggcaaaaaggcagcaacggatgcaggaaactgatgagcagagggcaaagcgtttgcagcgggatcgtgaggccatgcgtttgaaacgagccaatgagacaccagagaaacgccaggcaagattaattagagaacgagaagccaagcggttgaaaagaagattagaaaaaatggacatgatgttgcgagcacagtttgggcaggaccctgctgctatggtagctttagcagaaatgaacttttttcagcttcctgtagggaattctgacctagaacaacaattgctagggaagatggagcttgaaggtcaaaataatggtactctaccttgaccccctactgaggctgttttttggttttttttaacgcggcaagctgtgtttgccttaatcttaaaaacatggattaatggcacaaatttaaatgcctgtcagaatgtgaaactcttaaaaaccttctacccccatcactgctgagatacctggatgtgagcattttgttgcccctctgtatttactgtatttaaacagaaaggcattgtggtggatttcatccatctaccagtgctatctgtgttgctcaggatttgaaatctctttggagcagaaagctcttgtttgtttgtttgtgctttctgtctgtcatgcctttgctacagggtatgaatcgccaggtatggactatattcctggaacttctggattcccaaaaggttccactctgaacctatactgtgtgctaaacagggtataaaatacagacttttcattaaaaaaaaaaaaaaaaaaaa
Translation: MSRRKQTTPNKVHWEQVFAGLKQQAREAMMKTDIVKQEFSVFGQHERSSSDSEAEDTTIDELSSPTSEEDNLEREVKEEPGVSRTSRENELSGEMVSGAAHDSELFICPLCQLACETQEQLITHVYQHTAAVVSAKSYLCPVCGRALSSPGSLGRHLLIHSEDQLSNCALCGAQFSSHATFNSEKLPEVLSPDTWNQNNHKGSSSCEGKNPETSAVYPAGILLVCNNCTAYRKLMTDQTPTVRKWAARRQNEPAAARVQRLERERTAKKSRRDCETPEEREMRRMRDREAKRQQRMQETDEQRAKRLQRDREAMRLKRANETPEKRQARLIREREAKRLKRRLEKMDMMLRAQFGQDPAAMVALAEMNFFQLPVGNSDLEQQLLGKMELEGQNNGTLP
Donor tissue: neurula