ORFeome > a4gnt ORF1 – XORFeome v1.0

a4gnt ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: a4gnt
Gene ID: 5796042
Gene Page ID: 5796040
ORF Xenbase ID: 17262567

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099303
Original XGC clone length: 1020

Human orthology & disease relationships

NCBI Entrez ID: 51146
Ensembl gene IDs: ENSG00000118017
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 211900,230800,230900,231000,231005,607091,608013

Library Location

Plate ID: GDExl11006
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ840116
dbEST ID: 79657818
Trimmed Sequence: ATGTCCACAAAAGTAAAGATACTATCAATTTTACTGTGCCTGGCAGTTTCTGGCTTTGTCTATAAGGCTGCTAACAGAAAGACGGTTGTCAAGTTCATACCATTTTTATTTGATACAAAGATTACTCCTGATGACGTCTTATCTCCAGGAAATGGCATTTTTTTTATAGAGACCACAGACCGCATGGATCTACCCTCCCTAGTGTTGTGTGCAGTTGAGTCTGCAGCCCGTATTAACCCCAAGAAGCCTGTGGCTTTCTTCATGAAAGGGTTACCTGATATTAACTCAGTAGAAGAACACACCCTAGCACTGAACAGTTTCCCAACCCTTGCAACCTATAATAATATCTACCTTTTCCCCCTCCGGATGGAGAATTTGCTTACCGATACACCCCTTCTGCCTTGGTATGACAAGGTTAATCCAAAGAATGAAATCCATTGGTCTCATGTCAGTTCAGATGCCTCCAGGTTGGCACTGATGTATAAATATGGTGGTCTTTATATGGACACTGATATCATATCATTAAAACCTGTTCCAGAAAGAAACTTCCTAGTTGCTGAGAGCTCTCGAATCTCCAGCAATGGTGTTTTTGGGTTTGATTCTCATAGAGACTTCACTTGGACATGCATGGAAGACTTTGTCAAGAATTATAATGGAGCAATCTGGGGGACATCAAGGAACAGCCCCTTTTCACTCAAGTCCTAAAAAAATTTTAATTGGTGATATTCCTCCCTTCAAGGGTAATGAAAAATCTCAAGTTGTTGAAAACATCTTCATTCTTTAATTCCCTCCAACAA
Full Trace Sequence: TCGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCACAAAAGTAAAGATACTATCAATTTTACTGTGCCTGGCAGTTTCTGGCTTTGTCTATAAGGCTGCTAACAGAAAGACGGTTGTCAAGTTCATACCATTTTTATTTGATACAAAGATTACTCCTGATGACGTCTTATCTCCAGGAAATGGCATTTTTTTTATAGAGACCACAGACCGCATGGATCTACCCTCCCTAGTGTTGTGTGCAGTTGAGTCTGCAGCCCGTATTAACCCCAAGAAGCCTGTGGCTTTCTTCATGAAAGGGTTACCTGATATTAACTCAGTAGAAGAACACACCCTAGCACTGAACAGTTTCCCAACCCTTGCAACCTATAATAATATCTACCTTTTCCCCCTCCGGATGGAGAATTTGCTTACCGATACACCCCTTCTGCCTTGGTATGACAAGGTTAATCCAAAGAATGAAATCCATTGGTCTCATGTCAGTTCAGATGCCTCCAGGTTGGCACTGATGTATAAATATGGTGGTCTTTATATGGACACTGATATCATATCATTAAAACCTGTTCCAGAAAGAAACTTCCTAGTTGCTGAGAGCTCTCGAATCTCCAGCAATGGTGTTTTTGGGTTTGATTCTCATAGAGACTTCACTTGGACATGCATGGAAGACTTTGTCAAGAATTATAATGGAGCAATCTGGGGGACATCAAGGAACAGCCCCTTTTCACTCAAGTCCTAAAAAAATTTTAATTGGTGATATTCCTCCCTTCAAGGGTAATGAAAAATCTCAAGTTGTTGAAAACATCTTCATTCTTTAATTCCCTCCAACAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCACAAAAGTAAAGATA

Sequences - 3ʹ (reverse) EST

Accession: JZ840115
dbEST ID: 79657817
Trimmed Sequence: TAGTACATTAGTAAGGTGGGTACTTTTTTTCTCCTTAACAGCTTGATAAGTAGCAGGGCAATTCTGTATGTAAAGATGTTCCACCAATGTGTTGCTTCCTGGAACCATTACCCTACGCTCAGCACGATTGGCATAATTAAAGAGATGCAAAGCATAAGACTCATTGAAAGTTGGAATGGCTTTCCATACTTGAAAGAACTTCATCCAGTACTGACACTCAATTGGATAAAATCGTCGAGGATTTAAGAATGAGATGTTTCCACACTTGAGATCTTCATCACCCTTGAATGGAGGAATATCACAATAAAATTTCTTTAGGACTCGAGTGAAAAGGGCTGGTCCTTGATGTCCCCAGATTGCTCCATTATAATTCTTGACAAAGTCTTCCATGCATGTCCAAGTGAAGTCTCTATGAGAATCAAACCCAAAAACACCATTGCTGGAGATTCGAGAGCTCTCAGCAACTAGGAAGTTTCTTTCTGGAACAGGTTTTAATGATATGATATCANTGTCCATATAAAGACCACCATATTTATACATCAGTGCCAACCTGGAGGCATCTGAACTGACATGAGACCAATGGATTTCATTCTTTGGAATAACCTTGTCATACCAAGGCAAAAGGGGTGTATCGGTAAACCAATTTCTCCATCCGGAAGGGGAAAAGGTAAATAATATTATAGGTTTGAAAGGGTTGGGGAAACTGGTCAGTGCCTAGGGTGGGGTTCTTTCTAACTGATTTTAATAATCGGGGTAAACCCTTTTTCAGAA
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATAGTCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGTACATTAGTAAGGTGGGTACTTTTTTTCTCCTTAACAGCTTGATAAGTAGCAGGGCAATTCTGTATGTAAAGATGTTCCACCAATGTGTTGCTTCCTGGAACCATTACCCTACGCTCAGCACGATTGGCATAATTAAAGAGATGCAAAGCATAAGACTCATTGAAAGTTGGAATGGCTTTCCATACTTGAAAGAACTTCATCCAGTACTGACACTCAATTGGATAAAATCGTCGAGGATTTAAGAATGAGATGTTTCCACACTTGAGATCTTCATCACCCTTGAATGGAGGAATATCACAATAAAATTTCTTTAGGACTCGAGTGAAAAGGGCTGGTCCTTGATGTCCCCAGATTGCTCCATTATAATTCTTGACAAAGTCTTCCATGCATGTCCAAGTGAAGTCTCTATGAGAATCAAACCCAAAAACACCATTGCTGGAGATTCGAGAGCTCTCAGCAACTAGGAAGTTTCTTTCTGGAACAGGTTTTAATGATATGATATCANTGTCCATATAAAGACCACCATATTTATACATCAGTGCCAACCTGGAGGCATCTGAACTGACATGAGACCAATGGATTTCATTCTTTGGAATAACCTTGTCATACCAAGGCAAAAGGGGTGTATCGGTAAACCAATTTCTCCATCCGGAAGGGGAAAAGGTAAATAATATTATAGGTTTGAAAGGGTTGGGGAAACTGGTCAGTGCCTAGGGTGGGGTTCTTTCTAACTGATTTTAATAATCGGGGTAAACCCTTTTTCAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGTACATTAGTAAGGTGGGTAC