ORFeome > abhd6 ORF1 – XORFeome v1.0

abhd6 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: abhd6
Gene ID: 6256516
Gene Page ID: 966284
ORF Xenbase ID: 17262729

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054984
Original XGC clone length: 1014

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ839295
dbEST ID: 79656997
Trimmed Sequence: ATGGATATAGATGTACTAAACATGTTCCTGGTGGCAGGAGGGACCCTCCTTGTCCCTTTATTGGCTTTCATGACCTCCTTCCTCTTGTGGCCAGCAGCGCTCATCAGGATTTATTACTGGTACTGGCGCCGGGCCCTGGGGATGCAGGTTAAATATTCCAGCTATGGGAACTATAAATTTTGCTACACGGCCCGCGGGAAACCGGGAAACAAGCCGTCAGTGCTGATGCTTCACGGATTCTCTGCGCATAAGGACATGTGGCTGGGGATGGTTAAGTTCCTTCCCAAGAACCTTCACCTGGTGTGTGTGGATATGCCAGGCCACGAGGGCACCTCACGTTCGGCTTTAGATTACTACTCCATCTGCGGGCAAGTTAAGAGGATACACCAGTTTGTGGAAAGCATCGGACTGAACAAGAAGCCTTTCCATTTGGTCGGTACCTCGATGGGTGGAAATGTCGCTGGTGTTTATGCTGCTCAGCACCCGACTCATATCAGCAGCCTGACCCTTATCTGTCCTGCAGGCTTGATGTATCCNATTGAGAGTAAGTTCTTAAAACAGCTGAAAGTCCTGGAAAAATCTGGCGACAACCAGAGGATCCCCCTCATCCCATCCACAGCCCGAGAAATGGAGGACATGCTGAGACTCTGCTCTTTTTGTTCGCTTTAAGATCCCCCACCAAGTCCTGCAGGGTCTCATCCAAGAACCCCATTCCCATAATGAATTTTTACAAAAGCCTAATTTTTGGCTTTTTGTTTAATGAAAAAATCCAAGAACCAATTTTTGCACAAAAAAACCTTAAACAAAAATTAAATGGCC
Full Trace Sequence: CGGGGCCCAAATAAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATATAGATGTACTAAACATGTTCCTGGTGGCAGGAGGGACCCTCCTTGTCCCTTTATTGGCTTTCATGACCTCCTTCCTCTTGTGGCCAGCAGCGCTCATCAGGATTTATTACTGGTACTGGCGCCGGGCCCTGGGGATGCAGGTTAAATATTCCAGCTATGGGAACTATAAATTTTGCTACACGGCCCGCGGGAAACCGGGAAACAAGCCGTCAGTGCTGATGCTTCACGGATTCTCTGCGCATAAGGACATGTGGCTGGGGATGGTTAAGTTCCTTCCCAAGAACCTTCACCTGGTGTGTGTGGATATGCCAGGCCACGAGGGCACCTCACGTTCGGCTTTAGATTACTACTCCATCTGCGGGCAAGTTAAGAGGATACACCAGTTTGTGGAAAGCATCGGACTGAACAAGAAGCCTTTCCATTTGGTCGGTACCTCGATGGGTGGAAATGTCGCTGGTGTTTATGCTGCTCAGCACCCGACTCATATCAGCAGCCTGACCCTTATCTGTCCTGCAGGCTTGATGTATCCNATTGAGAGTAAGTTCTTAAAACAGCTGAAAGTCCTGGAAAAATCTGGCGACAACCAGAGGATCCCCCTCATCCCATCCACAGCCCGAGAAATGGAGGACATGCTGAGACTCTGCTCTTTTTGTTCGCTTTAAGATCCCCCACCAAGTCCTGCAGGGTCTCATCCAAGAACCCCATTCCCATAATGAATTTTTACAAAAGCCTAATTTTTGGCTTTTTGTTTAATGAAAAAATCCAAGAACCAATTTTTGCACAAAAAAACCTTAAACAAAAATTAAATGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATATAGATGTACTAAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839294
dbEST ID: 79656996
Trimmed Sequence: ATCGTGTTTCTTATGGTTGTCTGTGCTCTGAAGGGAAGACAAGAAGTCCGTCATGAGTTTGGCGCTTTTCCTGGGTCTCTCCATCACTACTGAGTGCCCGCAGTTCTCCAGAATCTCGACTTGGCACCCGCGGAGAGAACCAGCCAAAACTTCAGCGCCAGATACATCCAGAACCTGGTCTTGTTTACCCCAAATTATCTGGGTGGGAGCCATAATTTTGTTCATGTTTTCGTGCAAACTGTGTCTCGACTTCTCATCAACAAGAGCCAAAAATAGCTTTCTGTAAAACTCATTATGGGGAATGCGCTCATCGATGAGACCCTGCAGGACCTGCTGGGGGATCTTAAAGCGAACAAAAGAGCAGAGTCTCAGCATGTCCTCCATTTCTCCGGCTGTGGATGGGATGAGCGGGATCCTCTGGTTGTCGCCAGATTTTTCCAGGACTTTCAGCTGTTTTAAAAACTTACTCTCAATTGGATACATCAAGCCTGCAGGACAGATAAGGGTCAGGCTGCTGATATGAGTCGGGTGCTGAGCAGCATAAACACCAGCGAACTTTCCACCCATCGAGGTACCGACGAAATGGAAAAGCTTCTTGTTCAGTCCCGAGGCTTTCCCAAACTGGTGTATCCTCTTAACTTGGCCGCCAAATGGAATATTAATCTAAAACCCAAACCTGAAGGGCCCTTCGGGGGCCGGGCATAATCCCCCCACAACCCAGGGGAAAGGGTTCTTGGGGAAAGGAAAATTAAACCCATCCCCCCAGCCCC
Full Trace Sequence: GGCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCGTGTTTCTTATGGTTGTCTGTGCTCTGAAGGGAAGACAAGAAGTCCGTCATGAGTTTGGCGCTTTTCCTGGGTCTCTCCATCACTACTGAGTGCCCGCAGTTCTCCAGAATCTCGACTTGGCACCCGCGGAGAGAACCAGCCAAAACTTCAGCGCCAGATACATCCAGAACCTGGTCTTGTTTACCCCAAATTATCTGGGTGGGAGCCATAATTTTGTTCATGTTTTCGTGCAAACTGTGTCTCGACTTCTCATCAACAAGAGCCAAAAATAGCTTTCTGTAAAACTCATTATGGGGAATGCGCTCATCGATGAGACCCTGCAGGACCTGCTGGGGGATCTTAAAGCGAACAAAAGAGCAGAGTCTCAGCATGTCCTCCATTTCTCCGGCTGTGGATGGGATGAGCGGGATCCTCTGGTTGTCGCCAGATTTTTCCAGGACTTTCAGCTGTTTTAAAAACTTACTCTCAATTGGATACATCAAGCCTGCAGGACAGATAAGGGTCAGGCTGCTGATATGAGTCGGGTGCTGAGCAGCATAAACACCAGCGAACTTTCCACCCATCGAGGTACCGACGAAATGGAAAAGCTTCTTGTTCAGTCCCGAGGCTTTCCCAAACTGGTGTATCCTCTTAACTTGGCCGCCAAATGGAATATTAATCTAAAACCCAAACCTGAAGGGCCCTTCGGGGGCCGGGCATAATCCCCCCACAACCCAGGGGAAAGGGTTCTTGGGGAAAGGAAAATTAAACCCATCCCCCCAGCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCGTGTTTCTTATGGTTGTCTGT