ORFeome > abr ORF1 – XORFeome v1.0

abr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: abr
Gene ID: 5797121
Gene Page ID: 5797082
ORF Xenbase ID: 17262771

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042307
Original XGC clone length: 2589

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ823761
dbEST ID: 79641463
Trimmed Sequence: ATGGAACCCGTCAGCCACCAAGACATGCCACGTCTCTCCTGGATAGATACCCTGTACAGCAATTTTAACTACGGCACGGATGGATATGATGCCGAAGGCAATGAAGAACACAAAAACTCACGTGAAGGCTCTGAAACTATGCCCTACATTGACGAGTCACCCACCATGTCTCCTCAGCTCAGTGCCAGGAGCCAGGATAGTGTGGATGGGGTCTCACCAACTCCAACAGAGGTGCTGCTGCCTGGGGGGGAAAGTGAATCGGACAAGGGCCTGTTGATGAGAAAACTTGTCCTGTCGGGGGTTCTGGCAAGTGAAGAAATTTATATAAATCAACTGGAAGCTCTACTGCTGCCCATGAAGCCTCTGAAGGCTACTGCCAGCACTTCCCAGCCGGTGCTTACCTTGCAGCAAATAAATGATATTTTTTACAAAATTGAAGACATCTATCAGATGCATAAGGATTTCTATGACAAGCTATGCCCCATTGTGCAGCAGTGGGACAACAAGACAACAGTGGGACATCTCTTCCAGAAGCTGGCCACTCAGCTGGGGGTGTACAAGGCCTTCGTGGATAATTACAAATTTGCTTTGGAGACGGCAGAGAAATGCAGCCAGTGTAACGTCCAGTTCTTTAAAATCTCTGAGGATCTGAAAGTGAAAGGGCCCAAGGATTCAAAGGAACAGCCTCAGTCGGTTACCATGGAAGCATTGCTGTACAAACCCATAGATCGTGTGACACGGAGCACTTTGGTACTGCATGA
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACCCGTCAGCCACCAAGACATGCCACGTCTCTCCTGGATAGATACCCTGTACAGCAATTTTAACTACGGCACGGATGGATATGATGCCGAAGGCAATGAAGAACACAAAAACTCACGTGAAGGCTCTGAAACTATGCCCTACATTGACGAGTCACCCACCATGTCTCCTCAGCTCAGTGCCAGGAGCCAGGATAGTGTGGATGGGGTCTCACCAACTCCAACAGAGGTGCTGCTGCCTGGGGGGGAAAGTGAATCGGACAAGGGCCTGTTGATGAGAAAACTTGTCCTGTCGGGGGTTCTGGCAAGTGAAGAAATTTATATAAATCAACTGGAAGCTCTACTGCTGCCCATGAAGCCTCTGAAGGCTACTGCCAGCACTTCCCAGCCGGTGCTTACCTTGCAGCAAATAAATGATATTTTTTACAAAATTGAAGACATCTATCAGATGCATAAGGATTTCTATGACAAGCTATGCCCCATTGTGCAGCAGTGGGACAACAAGACAACAGTGGGACATCTCTTCCAGAAGCTGGCCACTCAGCTGGGGGTGTACAAGGCCTTCGTGGATAATTACAAATTTGCTTTGGAGACGGCAGAGAAATGCAGCCAGTGTAACGTCCAGTTCTTTAAAATCTCTGAGGATCTGAAAGTGAAAGGGCCCAAGGATTCAAAGGAACAGCCTCAGTCGGTTACCATGGAAGCATTGCTGTACAAACCCATAGATCGTGTGACACGGAGCACTTTGGTACTGCATGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACCCGTCAGCCACCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829070
dbEST ID: 79646772
Trimmed Sequence: CACATCCGTTGAGTAGTACAGAGTGCTGCGCTTTAATTCAGAAAAGCTGATTGGTGGGTGCTGCAGGTAGTAGAGCAGAACCTGGACCTGTGCCATGACATCGTGAGACCAGATGTCGGAAGCCAGATTCATATGGCCTTTAATCTCTACTTCCGAGGGCCTCAGTAATGTGGGTCCGAACACAGTCGCCAAATTATGGAGTGACATTTTGTTAATGGGTTCATTTTCTGCCACCTTTTTCAAGTGGTGAAGCAGGAAAAGGAAGGTAATCAGGTTAGGGTCTGGGAGAGAGCGTAGTAGGTGCATCATACAGTTCTCCTTGGCAGCAGGATCGGACAGAGCTATCCCTTCCATGAAAGCAAGGTACAGACGGTCTGTGAGGAGAGGCTCTGGCAGCTCACGGAAGTACAGTTTTAATGTTCCAGCAATTGCATTAATGTCCATGTCGCTCAGCATCATCAGGATGTCTTTGCTGTTTGCATCAAATGCAGCTTTCAGCGCTTGAATGTCAGTGGCCACTCCAGATATTCTGTAAATCCCGACCTCTTCGATTCCACGTTTTTCCACCTCCTCTATACACTGACGTACTATATATGGCACCTTGGAACGCTCTCGCTTAGTTACGACACTTATTTTAACCCCAAATACGCCCGTCTGTTTTTTTGGAAAGTGTCCTTTTTCAAGCTCATGGTCTCGACTGCCTAAATTTTCATGGGAAAAACTTCCCCTTTTA
Full Trace Sequence: TCGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACATCCGTTGAGTAGTACAGAGTGCTGCGCTTTAATTCAGAAAAGCTGATTGGTGGGTGCTGCAGGTAGTAGAGCAGAACCTGGACCTGTGCCATGACATCGTGAGACCAGATGTCGGAAGCCAGATTCATATGGCCTTTAATCTCTACTTCCGAGGGCCTCAGTAATGTGGGTCCGAACACAGTCGCCAAATTATGGAGTGACATTTTGTTAATGGGTTCATTTTCTGCCACCTTTTTCAAGTGGTGAAGCAGGAAAAGGAAGGTAATCAGGTTAGGGTCTGGGAGAGAGCGTAGTAGGTGCATCATACAGTTCTCCTTGGCAGCAGGATCGGACAGAGCTATCCCTTCCATGAAAGCAAGGTACAGACGGTCTGTGAGGAGAGGCTCTGGCAGCTCACGGAAGTACAGTTTTAATGTTCCAGCAATTGCATTAATGTCCATGTCGCTCAGCATCATCAGGATGTCTTTGCTGTTTGCATCAAATGCAGCTTTCAGCGCTTGAATGTCAGTGGCCACTCCAGATATTCTGTAAATCCCGACCTCTTCGATTCCACGTTTTTCCACCTCCTCTATACACTGACGTACTATATATGGCACCTTGGAACGCTCTCGCTTAGTTACGACACTTATTTTAACCCCAAATACGCCCGTCTGTTTTTTTGGAAAGTGTCCTTTTTCAAGCTCATGGTCTCGACTGCCTAAATTTTCATGGGAAAAACTTCCCCTTTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATCCGTTGAGTAGTACAG