ORFeome > acaa1 ORF1 – XORFeome v1.0

acaa1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: acaa1
Gene ID: 963073
Gene Page ID: 963067
ORF Xenbase ID: 17262795

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054299
Original XGC clone length: 1260

Human orthology & disease relationships

NCBI Entrez ID: 30
Ensembl gene IDs: ENSG00000060971
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 202370,203750,215100,231530,242100,245050,250950,266500,300000,300438,312170,606054,609015,609016,609975

Library Location

Plate ID: GDExl11002
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ839313
dbEST ID: 79657015
Trimmed Sequence: ATGCACAGGGTTCGGGTAGTGCTGGGCCACCTGCCGGCTAATTCTCGAGGAGTATGGGCAGAGAACAGCTCAGCGTCCGCGGACAAATCCCAGGACATTGTTATAGTTGCCGGCCGGAGGACCCCCATCTGCAAAGCGAAAAGAGGCGCCTTTAAGGAGACGACCCCTGATGAGCTGCTTTCCACTGTAATGACCGCTGTCCTGAAGGATGTGAATGTGAGCCCTGAGCTGCTGGGAGATATCTGTGTGGGAAATGTATTACAGCCGGGAGCTGGGGCATTGGTTGCAAGGATCGGTCAGTTTTTAAGTGGAATTCCTGAGAGTGTTCCTATACATGTAGTGAATAGACAGTGCTCCTCAGGTCTGCAGGCTATCATCAACGTTGCAGGTGGCATCAGAAATGGGTCATATGACATTGGTTTGGCATGTGGGATGGAGTCAATGAGCCTGAGAAGTGTAGGGAGTCCTGGAGATATCAGCTCTCGCACTATGGACTTCAGTAAAGCCAGAGACTGCCTGATCCCTATGGGGATTACCTCTGAAAATGTTGCAGAAAAATTCGGAGTCACCAGAGAAAAACAAGATTCCTTGGCCCTGGCCTCCCAACAAAGGGCGGCAGCGGCTCAAAGATCAGGGCGCTTTAAAGCGGAAATCGTTCCTGTAACCACCACCTTTACCGACCATCAGGGGCATACCAAAACCATAACGGTGACCGAAAAATGAGGGTGGTCGGGGCAAATACCCACCATGGAAGGGGTCCCAACCGGGCTTAAAACCCACCCCTTCAAGGGAAAGGGGGGAAAACCCCCCACCCGC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCACAGGGTTCGGGTAGTGCTGGGCCACCTGCCGGCTAATTCTCGAGGAGTATGGGCAGAGAACAGCTCAGCGTCCGCGGACAAATCCCAGGACATTGTTATAGTTGCCGGCCGGAGGACCCCCATCTGCAAAGCGAAAAGAGGCGCCTTTAAGGAGACGACCCCTGATGAGCTGCTTTCCACTGTAATGACCGCTGTCCTGAAGGATGTGAATGTGAGCCCTGAGCTGCTGGGAGATATCTGTGTGGGAAATGTATTACAGCCGGGAGCTGGGGCATTGGTTGCAAGGATCGGTCAGTTTTTAAGTGGAATTCCTGAGAGTGTTCCTATACATGTAGTGAATAGACAGTGCTCCTCAGGTCTGCAGGCTATCATCAACGTTGCAGGTGGCATCAGAAATGGGTCATATGACATTGGTTTGGCATGTGGGATGGAGTCAATGAGCCTGAGAAGTGTAGGGAGTCCTGGAGATATCAGCTCTCGCACTATGGACTTCAGTAAAGCCAGAGACTGCCTGATCCCTATGGGGATTACCTCTGAAAATGTTGCAGAAAAATTCGGAGTCACCAGAGAAAAACAAGATTCCTTGGCCCTGGCCTCCCAACAAAGGGCGGCAGCGGCTCAAAGATCAGGGCGCTTTAAAGCGGAAATCGTTCCTGTAACCACCACCTTTACCGACCATCAGGGGCATACCAAAACCATAACGGTGACCGAAAAATGAGGGTGGTCGGGGCAAATACCCACCATGGAAGGGGTCCCAACCGGGCTTAAAACCCACCCCTTCAAGGGAAAGGGGGGAAAACCCCCCACCCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACAGGGTTCGGGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839312
dbEST ID: 79657014
Trimmed Sequence: ATGCCCTGGGTATTCATACACAGCAGCAGCGCCCATTCCTGTTCCTATACACATGGACACAACACCAAATCCCCTTTTGCCTCTTCTCTTGAGCTCGTTGAGTAGGGTGACAGTCTGACGTGTCCCAGTACAGCCCAGTGGATGTCCCAGTGCAATGGCGCCACCATTAGGGTTCACTTTCTCCACAGGGATCCCCAGTTTCTCCACACAATACACAGCCTGGCTGGCGAATGCTTCATTAATTTCATATACATCAATGTCATGCACAGTTAAACCTGCTTTCTGCAAAGCAGCAGGTATAGCATAGGCTGGTCCAATCCCCATGACATCAGGAGGAACACCAACCACTGCAAATGACCTCAGTACCCCCAATATGGGGAGCCCCAACTGCTCAGCTCTAGAGCGTTTAGCCATCAGCACTGCAGCAGCACCATCACTGACCTGACTGGAATTTCCGGCGGTGGTGCTTCCCCCTTCCTTGAAGGCTGGCTTTAGCCTGCTGAGACCCTCCATGGTGGTACTTGCCCGAACACCCTCATCTTCCGTCACCGTTATGGTTTTGGTATTGCCCTGATCGTCGGTAAAGGGTGGTGGTTACAGGAACAATTTTCCGCTTTAAGCCCCCCTGATCTCTAAACCGCTCCCGCCCCTTTGTTGGGAAGGCCCGGGCCCAAGGAATTCTTGGTTTTTTTCTTCGGGGTGAACTCCCAAATTTTTTCCTCCCACCAATTTTTCCAAAAAAGTAA
Full Trace Sequence: CGAGCAATANGACTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGCCCTGGGTATTCATACACAGCAGCAGCGCCCATTCCTGTTCCTATACACATGGACACAACACCAAATCCCCTTTTGCCTCTTCTCTTGAGCTCGTTGAGTAGGGTGACAGTCTGACGTGTCCCAGTACAGCCCAGTGGATGTCCCAGTGCAATGGCGCCACCATTAGGGTTCACTTTCTCCACAGGGATCCCCAGTTTCTCCACACAATACACAGCCTGGCTGGCGAATGCTTCATTAATTTCATATACATCAATGTCATGCACAGTTAAACCTGCTTTCTGCAAAGCAGCAGGTATAGCATAGGCTGGTCCAATCCCCATGACATCAGGAGGAACACCAACCACTGCAAATGACCTCAGTACCCCCAATATGGGGAGCCCCAACTGCTCAGCTCTAGAGCGTTTAGCCATCAGCACTGCAGCAGCACCATCACTGACCTGACTGGAATTTCCGGCGGTGGTGCTTCCCCCTTCCTTGAAGGCTGGCTTTAGCCTGCTGAGACCCTCCATGGTGGTACTTGCCCGAACACCCTCATCTTCCGTCACCGTTATGGTTTTGGTATTGCCCTGATCGTCGGTAAAGGGTGGTGGTTACAGGAACAATTTTCCGCTTTAAGCCCCCCTGATCTCTAAACCGCTCCCGCCCCTTTGTTGGGAAGGCCCGGGCCCAAGGAATTCTTGGTTTTTTTCTTCGGGGTGAACTCCCAAATTTTTTCCTCCCACCAATTTTTCCAAAAAAGTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGCCCTGGGTATTCATACA