ORFeome > acad8 ORF1 – XORFeome v1.0

acad8 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: acad8
Gene ID: 955815
Gene Page ID: 955811
ORF Xenbase ID: 17262807

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056845
Original XGC clone length: 1245

Human orthology & disease relationships

NCBI Entrez ID: 27034
Ensembl gene IDs: ENSG00000151498,LRG_448
Directly associated (OMIM) disease MIM numbers: 611283
Indirectly associated (Lage, et al.) disease MIM numbers: 231670,248600,268300,312170,601003

Library Location

Plate ID: GDExl11002
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ839291
dbEST ID: 79656993
Trimmed Sequence: ATGGCGCTGTGCTACAGAGCAGGAGCTGTACTCTCCCGGCGTTTGAAAGGCGCTGCCGGCCAATGGACGCTGCCCTTCGCTAGACGAATTGCTTCCTGCATAGATCCTTCGGTTGGCCTCAGTGAAGAGCAAACAGAGTTTCAGAAAGTAGCCTTAGATTTTGCTGCTAAAGAAATGGCACCTCACATGGCTTTATGGGATGAAAAGGAAATATTTCCAGTGGAGACAATGAGAAAGGCAGCACAGCTGGGTTTTGGGGGAATATACACTCAGACTGATGTTGGAGGATCAGGGCTTTCTCGTCTAGACACATCCATAATATTTGAGGCATTATCAACAGGTTGTGTGAGCACTACTGCATATATGAGTATTCACAACATGTGTGTTTGGATGATTGATACATTTGGGAATGAAGAGCAGAGACACCGGTTTTGCCCATCCCTCTGTAGCATGGATAAGTTTGCATCATATTGCTTGACAGAGCCAGGTAGTGGAAGTGATGCAGCGTCTTTGTTGACCTCTGCAAAAAGGGATGGAGATTGCTACGTCCTTAATGGCTCANAGGCATTTATTAGTGGTGGAGGAGACACAGATGTCTATGTGGTAATGTGCCGCACAGGAGGAAGTGGAGCCCGAGGAATCTCTTGCCTAGTGGTGGAGAAAGGGACGCCTGGCCTGAGTTTTGGCAAGAAAGAAAAAAAGGTAGGGTGGAACTCCAAGCCAACTAAAGCAGTTATCTTTTAAGAATCGGGTATTCCCCTGTCCAAAAAAAAAACTTTTGAATGGGAAAGGCCAAGGGTTTTCAATTAATGGCCCT
Full Trace Sequence: CGGGGGCCCAAATAAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGTGCTACAGAGCAGGAGCTGTACTCTCCCGGCGTTTGAAAGGCGCTGCCGGCCAATGGACGCTGCCCTTCGCTAGACGAATTGCTTCCTGCATAGATCCTTCGGTTGGCCTCAGTGAAGAGCAAACAGAGTTTCAGAAAGTAGCCTTAGATTTTGCTGCTAAAGAAATGGCACCTCACATGGCTTTATGGGATGAAAAGGAAATATTTCCAGTGGAGACAATGAGAAAGGCAGCACAGCTGGGTTTTGGGGGAATATACACTCAGACTGATGTTGGAGGATCAGGGCTTTCTCGTCTAGACACATCCATAATATTTGAGGCATTATCAACAGGTTGTGTGAGCACTACTGCATATATGAGTATTCACAACATGTGTGTTTGGATGATTGATACATTTGGGAATGAAGAGCAGAGACACCGGTTTTGCCCATCCCTCTGTAGCATGGATAAGTTTGCATCATATTGCTTGACAGAGCCAGGTAGTGGAAGTGATGCAGCGTCTTTGTTGACCTCTGCAAAAAGGGATGGAGATTGCTACGTCCTTAATGGCTCANAGGCATTTATTAGTGGTGGAGGAGACACAGATGTCTATGTGGTAATGTGCCGCACAGGAGGAAGTGGAGCCCGAGGAATCTCTTGCCTAGTGGTGGAGAAAGGGACGCCTGGCCTGAGTTTTGGCAAGAAAGAAAAAAAGGTAGGGTGGAACTCCAAGCCAACTAAAGCAGTTATCTTTTAAGAATCGGGTATTCCCCTGTCCAAAAAAAAAACTTTTGAATGGGAAAGGCCAAGGGTTTTCAATTAATGGCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGTGCTACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839290
dbEST ID: 79656992
Trimmed Sequence: TTCTTGTAAAATGCTTCTGGCCACAATCATCCTCATAACTTCATTAGTTCCCTCAAGGATCTGATGGACACGAATATCTCGAACAAACTGTTGCACGGCATAATCTTTCAGGTATCCGTATCCTCCATGCATCTGCAAAGCTTGATTACAAATCTTAAAGCACTCATCCGTAGCAAACAATTTTGCCATAGCACAGAGAGTTGCTGCATCCCCAGTACCATTTTGCAAGGCGTCAGCTGCATGCCGTACAATGAGCCGTGATGTGACCAAGCGTGTTGCCATATCTGCCAGTTTGAACTGCAAGTACTGGTTATGGGCTAGAGGTTCCCCAAACTGCTTCCGCACAGCAAGGTGATCCCGAGTAAGCAATACTGAGGCATGAGCAGCTCCCAGAGAACAAGAAGCAATGTTTATTCTTCCTCCATTTAGGCCTTTCATGGCAATACTGAAACCTTGACCTTCCACTCCAAGTCTGTTTTTGACAGGGACTACACAGTCTTCAAAGATAACTGCTCTAGTTGGCTGTGAGTTCCACCCTACCTTCTTCTCTTTCTTGCCAAAACTCANGCCAGGCGTCCCTTTCTCCACCACTAGGCCAAAGATTCCTCGGGCTCCACTTCCTCCTGTGCGGCACATTACCACATAGACATTCTTTGTCTCCTCCACCACTAAAAAAATGCTTTTAACCCATTAAAGGACTTAACAATTCCTCCATCCCTTTTTTTTGCAAAAGGTTCAAAAAAAGAAACCCTTTCATTCCACTTTTCACCTA
Full Trace Sequence: CGGGAAACANGTCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTGTAAAATGCTTCTGGCCACAATCATCCTCATAACTTCATTAGTTCCCTCAAGGATCTGATGGACACGAATATCTCGAACAAACTGTTGCACGGCATAATCTTTCAGGTATCCGTATCCTCCATGCATCTGCAAAGCTTGATTACAAATCTTAAAGCACTCATCCGTAGCAAACAATTTTGCCATAGCACAGAGAGTTGCTGCATCCCCAGTACCATTTTGCAAGGCGTCAGCTGCATGCCGTACAATGAGCCGTGATGTGACCAAGCGTGTTGCCATATCTGCCAGTTTGAACTGCAAGTACTGGTTATGGGCTAGAGGTTCCCCAAACTGCTTCCGCACAGCAAGGTGATCCCGAGTAAGCAATACTGAGGCATGAGCAGCTCCCAGAGAACAAGAAGCAATGTTTATTCTTCCTCCATTTAGGCCTTTCATGGCAATACTGAAACCTTGACCTTCCACTCCAAGTCTGTTTTTGACAGGGACTACACAGTCTTCAAAGATAACTGCTCTAGTTGGCTGTGAGTTCCACCCTACCTTCTTCTCTTTCTTGCCAAAACTCANGCCAGGCGTCCCTTTCTCCACCACTAGGCCAAAGATTCCTCGGGCTCCACTTCCTCCTGTGCGGCACATTACCACATAGACATTCTTTGTCTCCTCCACCACTAAAAAAATGCTTTTAACCCATTAAAGGACTTAACAATTCCTCCATCCCTTTTTTTTGCAAAAGGTTCAAAAAAAGAAACCCTTTCATTCCACTTTTCACCTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTGTAAAATGCTTCTGGCCAC