ORFeome > acer2 ORF1 – XORFeome v1.0

acer2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: acer2
Gene ID: 6252796
Gene Page ID: 1015551
ORF Xenbase ID: 17262879

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123169
Original XGC clone length: 828

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ838083
dbEST ID: 79655785
Trimmed Sequence: ATGGGCGCTTTAAAGATCTGGGAGCATCTTCAGGCAGGCAGCTCAGAAGTGGACTGGTGCGAGGACAATTACACCATAGTGTCTTCAATCGCAGAGTTCTACAATACGATCAGCAACATTTTATTTTTTGTGTTACCGCCCATATGCATGTGTCTATTCCGTCAGTACGCAACCTGCTTCAACAGTGGGATATATTTAATATGGACTCTGCTGGTTGTTGTCGGTATTGGCTCCGTGTATTTCCATGCCACGCTCAGTTTTCTCGGGCAAATGCTGGATGAGTTGGCTATCCTGTGGGTGCTAGTGTCTGCATTAGCCATGTGGTTTCCTAAAAAACATCTACCGGGGGTATTTCTAAATGACAGGAGGAGGGTTGGTCAATTTTTGAGAGGGGTTCATAGGGTCTCGCGCCAACCCAGTGGTTTCCCTGCGCGGGGGGTGAAAGGACTCTTGAGGGAGGGGGGGGGGTAAACAGGACCGGACATACTGTTGGGCAGCGCTCAAAGGTGGTAAAAAATTCTCGGTTGAAACGGTGGGTAAGATGCCGGGGTTGGGAGGGATATGTGCGAGGGGGCGTGTGGGAACCCCACCCAGTTTGTGGGGGGAAGAAGAGGTGAGGGGGGGGGGGTCAACGGGGGGGGGGGGGGGGGGACCATTTCGCGGGTCGGGGGATAATAAGGGGGGGGGGGCTTCCTTTCTTTGTGTTGGGGGGGCGAGCGGAAGCGGGGAAGGGGGGGAGGGGGTAAAAAGGGTTGGGGAAAAGAGAGGGGGGGTGGGTCGCGGGGGG
Full Trace Sequence: GGGTGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCGCTTTAAAGATCTGGGAGCATCTTCAGGCAGGCAGCTCAGAAGTGGACTGGTGCGAGGACAATTACACCATAGTGTCTTCAATCGCAGAGTTCTACAATACGATCAGCAACATTTTATTTTTTGTGTTACCGCCCATATGCATGTGTCTATTCCGTCAGTACGCAACCTGCTTCAACAGTGGGATATATTTAATATGGACTCTGCTGGTTGTTGTCGGTATTGGCTCCGTGTATTTCCATGCCACGCTCAGTTTTCTCGGGCAAATGCTGGATGAGTTGGCTATCCTGTGGGTGCTAGTGTCTGCATTAGCCATGTGGTTTCCTAAAAAACATCTACCGGGGGTATTTCTAAATGACAGGAGGAGGGTTGGTCAATTTTTGAGAGGGGTTCATAGGGTCTCGCGCCAACCCAGTGGTTTCCCTGCGCGGGGGGTGAAAGGACTCTTGAGGGAGGGGGGGGGGTAAACAGGACCGGACATACTGTTGGGCAGCGCTCAAAGGTGGTAAAAAATTCTCGGTTGAAACGGTGGGTAAGATGCCGGGGTTGGGAGGGATATGTGCGAGGGGGCGTGTGGGAACCCCACCCAGTTTGTGGGGGGAAGAAGAGGTGAGGGGGGGGGGGTCAACGGGGGGGGGGGGGGGGGGACCATTTCGCGGGTCGGGGGATAATAAGGGGGGGGGGGCTTCCTTTCTTTGTGTTGGGGGGGCGAGCGGAAGCGGGGAAGGGGGGGAGGGGGTAAAAAGGGTTGGGGAAAAGAGAGGGGGGGTGGGTCGCGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCGCTTTAAAGATCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838082
dbEST ID: 79655784
Trimmed Sequence: TGTAATTTTAATGGGCGCTTTCTTGTTTGCACAGAGTAAAGTGACATAAGGCACTCCAATGAAGGCCCACTTTTCACTAGGCCAAAATCTGATGACAGGTCCCTGCTCTGGGATTTCAGATGCGGCATGAAAGTAAGCGAAGCAGACACAGCCCAGATAAGCAGCCAGACAGATAAGGATGTGCCATACACAGTGGAGGTAGGGAAAGTTGAAAGATGAACATATTTCACAAAAAGCTTTGTCGCTGATCCAACAGGCCAATGCCAATGTCCACCAAAATCCAGACATTAGGCCAAGCTTGTAAACCCGCATGTTGTCACATCTCTTGAGCTCAGCAATGAGTAAGACTGTACATGGTATCCCCAGTGTCATCAGGGATATGCTGTTAATGGCAGGCTTGATAAACCCTAGGGCTGTGGTGACTCCCGAAAGCACCCCAACAACTGCTTTAAACCTCCACCTGTCATTTCGAAATACCCTTGGCAGATGTCTTTTAGGAAACCACATGGCTAAGGCAGACATTAGCACCCCCAGGATAGCCCACTCATCCCGCATTTGCCCGAGAAAACTGAGCGTGGCATGGAAATACACGGACCCAAAACCGAACAACAACCACCAGAATTCAATATTAAATATATCCCCCTGTTTAAGCAGGGTTGCTTACTGGACGGAAAAAAAAACCAGCCATTTGGGGCGGGTAACAAAAAAAAATAAAAATGTTTGCCTAAATCGGAAGTGGAAAAAAATTCTTGGAAATTGAAAAAAACCCTAATGAGGGG
Full Trace Sequence: GGGAAAATGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTAATTTTAATGGGCGCTTTCTTGTTTGCACAGAGTAAAGTGACATAAGGCACTCCAATGAAGGCCCACTTTTCACTAGGCCAAAATCTGATGACAGGTCCCTGCTCTGGGATTTCAGATGCGGCATGAAAGTAAGCGAAGCAGACACAGCCCAGATAAGCAGCCAGACAGATAAGGATGTGCCATACACAGTGGAGGTAGGGAAAGTTGAAAGATGAACATATTTCACAAAAAGCTTTGTCGCTGATCCAACAGGCCAATGCCAATGTCCACCAAAATCCAGACATTAGGCCAAGCTTGTAAACCCGCATGTTGTCACATCTCTTGAGCTCAGCAATGAGTAAGACTGTACATGGTATCCCCAGTGTCATCAGGGATATGCTGTTAATGGCAGGCTTGATAAACCCTAGGGCTGTGGTGACTCCCGAAAGCACCCCAACAACTGCTTTAAACCTCCACCTGTCATTTCGAAATACCCTTGGCAGATGTCTTTTAGGAAACCACATGGCTAAGGCAGACATTAGCACCCCCAGGATAGCCCACTCATCCCGCATTTGCCCGAGAAAACTGAGCGTGGCATGGAAATACACGGACCCAAAACCGAACAACAACCACCAGAATTCAATATTAAATATATCCCCCTGTTTAAGCAGGGTTGCTTACTGGACGGAAAAAAAAACCAGCCATTTGGGGCGGGTAACAAAAAAAAATAAAAATGTTTGCCTAAATCGGAAGTGGAAAAAAATTCTTGGAAATTGAAAAAAACCCTAATGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTAATTTTAATGGGCGCTTTCTT