ORFeome > acin1 ORF1 – XORFeome v1.0

acin1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: acin1
Gene ID: 959541
Gene Page ID: 959535
ORF Xenbase ID: 17262891

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC108818
Original XGC clone length: 1920

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ837731
dbEST ID: 79655433
Trimmed Sequence: ATGTTTGAGTGTAGCTCCCCTGCCGGAGAGCGAGCTAAATTTGGTAGTACCGGGACCAGGCCAGAGACCCGCGGCTGCCTTCGCTCTTCTCTCTTTTTCTTTTCCCCGCTGCTTCTTGTTCCCTTTCTTCCTCTCAGCTTATCCATTCGACCTCCAAAGGTTCCTCCCTCCTCCCGTCCCTCCCCCCTTTTCCTTCAGCCGGCTGCCAGGGAAATGTTATCAGAAAACAAAGACTGCACACCAGAGAGTGAGGACGTGGTGATGGAGGCTGCAGAGTGTCAAACAGAGGGTGAGACCCAAGAGGCTGCACCCCCACAGTCCTCATAGGAATGTTGTGAAGGAGATGACAAAAAAGAGAGTACTACTCCACCAAGAACATTCAAACGGAAGATCTCTGTTATATCTGCCAGTAAATGTTCTATTCAGCCTTCATCATCCACTACAATGAACAGCGACAATGAGGGTGCTCATCCAGCAAGACGGAGGCGCTGGGGAGCCAGTACAGCAACAACACAGAAAAAACCCTCCATAAGCATCTCAACTGAATCACTTAAGAATCTAATCCCAGAGATAAAGGAGATAAAGCAAGAGGCAGTGGTGGACCTTCATGCTGAAGACACTCAAATTTCTGAAGATGAGGCAGAGAGGAAATGGAGATGACAGTTCCCATGACAAAGGCTTCAAAATTTGCAAAACCGGTTACCCAGGGTGGTACC
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTGAGTGTAGCTCCCCTGCCGGAGAGCGAGCTAAATTTGGTAGTACCGGGACCAGGCCAGAGACCCGCGGCTGCCTTCGCTCTTCTCTCTTTTTCTTTTCCCCGCTGCTTCTTGTTCCCTTTCTTCCTCTCAGCTTATCCATTCGACCTCCAAAGGTTCCTCCCTCCTCCCGTCCCTCCCCCCTTTTCCTTCAGCCGGCTGCCAGGGAAATGTTATCAGAAAACAAAGACTGCACACCAGAGAGTGAGGACGTGGTGATGGAGGCTGCAGAGTGTCAAACAGAGGGTGAGACCCAAGAGGCTGCACCCCCACAGTCCTCATAGGAATGTTGTGAAGGAGATGACAAAAAAGAGAGTACTACTCCACCAAGAACATTCAAACGGAAGATCTCTGTTATATCTGCCAGTAAATGTTCTATTCAGCCTTCATCATCCACTACAATGAACAGCGACAATGAGGGTGCTCATCCAGCAAGACGGAGGCGCTGGGGAGCCAGTACAGCAACAACACAGAAAAAACCCTCCATAAGCATCTCAACTGAATCACTTAAGAATCTAATCCCAGAGATAAAGGAGATAAAGCAAGAGGCAGTGGTGGACCTTCATGCTGAAGACACTCAAATTTCTGAAGATGAGGCAGAGAGGAAATGGAGATGACAGTTCCCATGACAAAGGCTTCAAAATTTGCAAAACCGGTTACCCAGGGTGGTACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTGAGTGTAGCTCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837730
dbEST ID: 79655432
Trimmed Sequence: ACGCCGGCCTCCCCTGTCTCTCACTGGTGTACTTCTACTGCGGCTGTGCCTCTTAGTTTCCCGCCGCTCTCTTTCACGCGGGTGCTCTCTACTGTGTTCTCTTCTCTTTTCTCGGTCAGCCTCTCGTGCTCTCTCTCGATTTCTCTCAGCCTCTTTTTCCCTCTCCTTTGCCCTCTCTTTTCTCTCCTCCTCTTCTTGCTCCTCTTGCTCCTTCCGTCGCTTCTCTCGCTCCTTGGCACGCTCTGCCCTATCTGCAACTTTTTTCAGAATCTGGTCTTCGGTGAGTGGGAGCCAATATATACCATGGGCACCTTTGGTTTTGTGAAATATATCATCCAAAAGTTTTGCTGGGGGTTCTTCTTGTACTTTCACTTTCTTTTCATTTTTCTTCACCTTGTACTTTTCATGTTCTTTCCTCCTACAGTCTCGATAGGGTGATCTGGGTCCTTCCCGGATCTTGTCTCTATCCCACTCTCTCTCTGAACGTGTGCGTTCTCTTCTTTCCATCTCTCGCTCTCTCTCTGCCCACTGCTCTCTTGCTCCTCGATCATGTTCCCTGTGTTCACCTCGCAGAGCAGGGACGTGTGGGTGGGGATGAAGTTGTTCGTTCAGTTTGGACTCTGGTGGAAACTCCCACGAAAAAGGCAGATGGAAGGCGAAGTCGATCTGAGTCAGAAAGACGACAAAAAGAAATTATGGATTGGACTATGGCCATTTCACTCAAGAAGAAATTAAGAGTTGCAACTACTTCTAATAATAAAAATAATTGAAGAACAGTGAGAGTTATTTGTATGTTGCAAAATTTTGCTTAACAATAAAACATATAACAAGAACAAGTCGTTAATTGTCCTGAAGTGAAAACGAAAACGAGAAGCGATATGAACAAATGAAGAGAGGTTGGTGTCAGGGGGAAAGAGGAAAGTAAAAATCCGGTCAGAAAAAGAAAGAGTAAGAGAGGAGAAAGTCCAAGTCCCCAGGCGTGAATTAAAGAATCTAGAAAAGATGAGGTGGCAGAGTAGGACCTGAACTTACTACATTAAAGAAAATGTGGCGAGGGGGGGGTAGGAGAGGATATGGAGAGAGGGGGAGGGAGAAGCGAAAAGAAAAAGACTACCAGANGAGAAAAAAAAACTGAAATGGCGACTGGTN
Full Trace Sequence: GTGCCAGGCATCTAGCTATGACCATGTAATACGACTCACTATNAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGCCGGCCTCCCCTGTCTCTCACTGGTGTACTTCTACTGCGGCTGTGCCTCTTAGTTTCCCGCCGCTCTCTTTCACGCGGGTGCTCTCTACTGTGTTCTCTTCTCTTTTCTCGGTCAGCCTCTCGTGCTCTCTCTCGATTTCTCTCAGCCTCTTTTTCCCTCTCCTTTGCCCTCTCTTTTCTCTCCTCCTCTTCTTGCTCCTCTTGCTCCTTCCGTCGCTTCTCTCGCTCCTTGGCACGCTCTGCCCTATCTGCAACTTTTTTCAGAATCTGGTCTTCGGTGAGTGGGAGCCAATATATACCATGGGCACCTTTGGTTTTGTGAAATATATCATCCAAAAGTTTTGCTGGGGGTTCTTCTTGTACTTTCACTTTCTTTTCATTTTTCTTCACCTTGTACTTTTCATGTTCTTTCCTCCTACAGTCTCGATAGGGTGATCTGGGTCCTTCCCGGATCTTGTCTCTATCCCACTCTCTCTCTGAACGTGTGCGTTCTCTTCTTTCCATCTCTCGCTCTCTCTCTGCCCACTGCTCTCTTGCTCCTCGATCATGTTCCCTGTGTTCACCTCGCAGAGCAGGGACGTGTGGGTGGGGATGAAGTTGTTCGTTCAGTTTGGACTCTGGTGGAAACTCCCACGAAAAAGGCAGATGGAAGGCGAAGTCGATCTGAGTCAGAAAGACGACAAAAAGAAATTATGGATTGGACTATGGCCATTTCACTCAAGAAGAAATTAAGAGTTGCAACTACTTCTAATAATAAAAATAATTGAAGAACAGTGAGAGTTATTTGTATGTTGCAAAATTTTGCTTAACAATAAAACATATAACAAGAACAAGTCGTTAATTGTCCTGAAGTGAAAACGAAAACGAGAAGCGATATGAACAAATGAAGAGAGGTTGGTGTCAGGGGGAAAGAGGAAAGTAAAAATCCGGTCAGAAAAAGAAAGAGTAAGAGAGGAGAAAGTCCAAGTCCCCAGGCGTGAATTAAAGAATCTAGAAAAGATGAGGTGGCAGAGTAGGACCTGAACTTACTACATTAAAGAAAATGTGGCGAGGGGGGGGTAGGAGAGGATATGGAGAGAGGGGGAGGGAGAAGCGAAAAGAAAAAGACTACCAGANGAGAAAAAAAAACTGAAATGGCGACTGGTN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGCCGGCCTCCCCTGT