ORFeome > ackr4 ORF1 – XORFeome v1.0

ackr4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ackr4
Gene ID: 6255310
Gene Page ID: 6258926
ORF Xenbase ID: 17262903

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082897
Original XGC clone length: 1071

Human orthology & disease relationships

NCBI Entrez ID: 51554
Ensembl gene IDs: ENSG00000129048
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 193670,275355,609423

Library Location

Plate ID: GDExl11004
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ839788
dbEST ID: 79657490
Trimmed Sequence: ATGGAGGAAAAAATCAATACCACAAGAAGAGCATCATGCAGAAAACTATGATGAATATGGAGACACCACCTTTGACTATGGTAATTACGAAGAGCTCTGTGAGAAGAAGGAAGTTCGACAGTTTGCACAGATTTTCCTCCCTGCTTTCTATGCTGTGGCATTCGTGATAGGGGTGGCTGGGAATTCTCTAGTGGTTGCCATATACTCTTATTACAAGAAGATGAAAAGCAAGACTGATGTGTACCTTATTAATCTGGAAGTAGCCGACCTTTTACTTCTATTTACACTACCTTTCTGGGCAACTGATGCTGCTGTAGGGTGGCAGTTTGGCATATTCATGTGCAAGATAACTTCTGCTTTGTATACTATAAATTTCAACTCACGTATGCAGTTCCTGGCTTGTATTAGTCTAGACAGATATTTTGCTGTAACCAAGGCTCCCAGTGCACAACCTGTTGGAAAGATGGGTCGAGTAATCTGTCTCTTTGTCTGGAGTACTTCTATGCTGTTGAGTATTCTGTATTTATATTTCACCACAGTGAACGAACATAATAACAAGCACGCATGCCTTCCAGTATACCCTAAAGATAAGGTAAAGCAAACCACTGTCTTGGACTGGATTTTTGGAGAAAGTATTTTGCTTTTTTTGCCGACCTTTCTTGGTATGGTAATTTGGTTATGCATCAATGGCCAAAAATTGTGCCTAAAACTCCCCAATATTAAAAAAATCAAATCCCCTTAGGGGGCTGTTTGGCCAGGGGGTTGCGTCCTTTCCTGGTAACTTCAATTTACCGTTTTTATGGTAATTTAAATTTTCGGGAGGGGCTTTTAC
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAAAAATCAATACCACAAGAAGAGCATCATGCAGAAAACTATGATGAATATGGAGACACCACCTTTGACTATGGTAATTACGAAGAGCTCTGTGAGAAGAAGGAAGTTCGACAGTTTGCACAGATTTTCCTCCCTGCTTTCTATGCTGTGGCATTCGTGATAGGGGTGGCTGGGAATTCTCTAGTGGTTGCCATATACTCTTATTACAAGAAGATGAAAAGCAAGACTGATGTGTACCTTATTAATCTGGAAGTAGCCGACCTTTTACTTCTATTTACACTACCTTTCTGGGCAACTGATGCTGCTGTAGGGTGGCAGTTTGGCATATTCATGTGCAAGATAACTTCTGCTTTGTATACTATAAATTTCAACTCACGTATGCAGTTCCTGGCTTGTATTAGTCTAGACAGATATTTTGCTGTAACCAAGGCTCCCAGTGCACAACCTGTTGGAAAGATGGGTCGAGTAATCTGTCTCTTTGTCTGGAGTACTTCTATGCTGTTGAGTATTCTGTATTTATATTTCACCACAGTGAACGAACATAATAACAAGCACGCATGCCTTCCAGTATACCCTAAAGATAAGGTAAAGCAAACCACTGTCTTGGACTGGATTTTTGGAGAAAGTATTTTGCTTTTTTTGCCGACCTTTCTTGGTATGGTAATTTGGTTATGCATCAATGGCCAAAAATTGTGCCTAAAACTCCCCAATATTAAAAAAATCAAATCCCCTTAGGGGGCTGTTTGGCCAGGGGGTTGCGTCCTTTCCTGGTAACTTCAATTTACCGTTTTTATGGTAATTTAAATTTTCGGGAGGGGCTTTTAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAAAAATCAATACCACA

Sequences - 3ʹ (reverse) EST

Accession: JZ839787
dbEST ID: 79657489
Trimmed Sequence: GATAGAAAAGCTGCTGGTTTCTTCAACATGGTTTTCTGAATGCATAGAGAACTCTTCAGTGCTGTGTATTCTTTGTCCTCGTAAGGAGCCACATCTTTTTGCAATCTTTGAAATGTAACATTTAAACGTTGTCCCCATGAAGGCATATAGAACTGGATTGAGGCAACAGTGAAACAAGGCTAAACTTTCAGTCACCTGAATCATAATATCAATGGTTCTGCTCATACTGCAACTAGTTATTAAGGCATATATGATATCTATAGCCCTCCAGAACTTAATTACATTATATGGTAATTGAGTTACTAGGAAGACGCCAACCACTGCCAACAGCACCTTAAGAGATCTTGATCTTTTAATATTGGGAGTTTTTAGCACAATTTTTGCCATTGATGCATAGCAAAATACCATGACAAGAAATGGCAGCAAAAAGCAAAATACTATCTCCAAAATCTGGATCAAGACAGTGGTTTGCTTTACCTTATCTTTAGGGTATACTGGAAGGCATGCGTGCTTGTTATTATGTTCCTTCACTGTGCTGAATTATAAAATCTGGAATACTCAACAGCATAGAAGTACTCCAGAACAAGACGACAGATAACCGAACCATCTTTTCCACAGGTTGTGGACTGGGAGCCTTGGTTACAGCAAAATAACTGTCTGGACTAATACAACCCAGGGAATGGAATACCGGAATCTGAAATTTTAAGTATTCAAAAGCAAAAGTTAATCTTTGCCAATGGAATATGCCAAAACTTGCCCACCCTTAAGGCACAC
Full Trace Sequence: GCACGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATAGAAAAGCTGCTGGTTTCTTCAACATGGTTTTCTGAATGCATAGAGAACTCTTCAGTGCTGTGTATTCTTTGTCCTCGTAAGGAGCCACATCTTTTTGCAATCTTTGAAATGTAACATTTAAACGTTGTCCCCATGAAGGCATATAGAACTGGATTGAGGCAACAGTGAAACAAGGCTAAACTTTCAGTCACCTGAATCATAATATCAATGGTTCTGCTCATACTGCAACTAGTTATTAAGGCATATATGATATCTATAGCCCTCCAGAACTTAATTACATTATATGGTAATTGAGTTACTAGGAAGACGCCAACCACTGCCAACAGCACCTTAAGAGATCTTGATCTTTTAATATTGGGAGTTTTTAGCACAATTTTTGCCATTGATGCATAGCAAAATACCATGACAAGAAATGGCAGCAAAAAGCAAAATACTATCTCCAAAATCTGGATCAAGACAGTGGTTTGCTTTACCTTATCTTTAGGGTATACTGGAAGGCATGCGTGCTTGTTATTATGTTCCTTCACTGTGCTGAATTATAAAATCTGGAATACTCAACAGCATAGAAGTACTCCAGAACAAGACGACAGATAACCGAACCATCTTTTCCACAGGTTGTGGACTGGGAGCCTTGGTTACAGCAAAATAACTGTCTGGACTAATACAACCCAGGGAATGGAATACCGGAATCTGAAATTTTAAGTATTCAAAAGCAAAAGTTAATCTTTGCCAATGGAATATGCCAAAACTTGCCCACCCTTAAGGCACAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATAGAAAAGCTGCTGGTTTCTT