ORFeome > acp6 ORF1 – XORFeome v1.0

acp6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: acp6
Gene ID: 6252766
Gene Page ID: 994567
ORF Xenbase ID: 17262957

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC154980
Original XGC clone length: 1254

Human orthology & disease relationships

NCBI Entrez ID: 51205
Ensembl gene IDs: ENSG00000162836
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 139300,140350,200950,203500,208000,240600,241500,241510,264600,270200,276710,307030,602475,608643

Library Location

Plate ID: GDExl11093
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ838994
dbEST ID: 79656696
Trimmed Sequence: ATGAGTCTGTGGGCACGGGCCGGCCTCCTGGGCTCAGTCATTTACCTGCTGCATAGGAAGAAGACTGTCCTGACTGAAGTGAAACAGAGCTGCTGGTGGTGTTGGCAGACATGGGCACGAGTATGAGTTAAAGCTGGTGCAGGTTATATATCGGCATGGCGCCAGGACCCCACTCAAGCCCATCCCTCACGAGGACCAGGTGGAGTGGTCCCCAGCAATGCTGGTGGCTCCGGATCACACGCAGTTTGACTACATCGTTACAGACTTGGTGGGGGGTCCCAAACCTCCGTCTCCATTTGAGGAACGCTACCGATCTCATACACTCAAGGGCGGTACATTCCCGGGGCAGCTGACGACGGTGGGCATGAAGCAGATGTTTAACCTGGGACAGCGGCTCCGAAGGGATTACATAGAGGAGCAGAACTTTCTTTCGCCAGTGTTTAAATCATCAGAGGTCTTCGTCCGTTCTACTAACATTGTGCGCAATATGGAATCAACACGCTGTTTGCTGGCTGGACTCTTCCTACAACAGCAAGAAGGACCAGTGACCATCGTAACTGCCGACGCCAACGCTGAAATTTTTTATCCCTACTACCATGGCTGCCAAGGGCTTTAACAGCTGACCACTAACAAGACGTCCAATTGCCTCCTCCGGCCCGGGAAGGTCGGAAGATCTGAAAAAGCTTCGGCCAGAAAATAACATTTGACCCTACTAAGGAAGTTAAATTTGTTTTTTTCTCTCCCCAAACCTTTTCCCCCAAAAAGGTCCGGGGAATTTCCCCTCGCCGCTTGGGTGCGCGGGTCGACCCTTCGCCGGAAG
Full Trace Sequence: CGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTCTGTGGGCACGGGCCGGCCTCCTGGGCTCAGTCATTTACCTGCTGCATAGGAAGAAGACTGTCCTGACTGAAGTGAAACAGAGCTGCTGGTGGTGTTGGCAGACATGGGCACGAGTATGAGTTAAAGCTGGTGCAGGTTATATATCGGCATGGCGCCAGGACCCCACTCAAGCCCATCCCTCACGAGGACCAGGTGGAGTGGTCCCCAGCAATGCTGGTGGCTCCGGATCACACGCAGTTTGACTACATCGTTACAGACTTGGTGGGGGGTCCCAAACCTCCGTCTCCATTTGAGGAACGCTACCGATCTCATACACTCAAGGGCGGTACATTCCCGGGGCAGCTGACGACGGTGGGCATGAAGCAGATGTTTAACCTGGGACAGCGGCTCCGAAGGGATTACATAGAGGAGCAGAACTTTCTTTCGCCAGTGTTTAAATCATCAGAGGTCTTCGTCCGTTCTACTAACATTGTGCGCAATATGGAATCAACACGCTGTTTGCTGGCTGGACTCTTCCTACAACAGCAAGAAGGACCAGTGACCATCGTAACTGCCGACGCCAACGCTGAAATTTTTTATCCCTACTACCATGGCTGCCAAGGGCTTTAACAGCTGACCACTAACAAGACGTCCAATTGCCTCCTCCGGCCCGGGAAGGTCGGAAGATCTGAAAAAGCTTCGGCCAGAAAATAACATTTGACCCTACTAAGGAAGTTAAATTTGTTTTTTTCTCTCCCCAAACCTTTTCCCCCAAAAAGGTCCGGGGAATTTCCCCTCGCCGCTTGGGTGCGCGGGTCGACCCTTCGCCGGAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCTGTGGGCACGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838993
dbEST ID: 79656695
Trimmed Sequence: AATCTTCTCTGTGTCTGTAATGGAACACTGCGCCTTGTAATCTTCTGGGCTTAACGCAAACTCGGATAACGCCCCGAGGAATTCTCTTAATGGGCAGAGACCCGACTGGCATCCTCTCACCTCCTGCTCCTCTCCGTTGTATCGGAGGCTCACAAACCAGTCCTTGGAGCGCCGGTGCTGGTAAAGTTCTAACGTCAGATCGGAGGCGTAGGGAGGCCACTTCTTGTTAAAGATCCCAAGAGCCATCAGGAGGGGTATCAGGGTGACATCATGGGCAGCATAGAGATAGAACTTCCTGGCCTGTGTCTCTGCACCTGCTCTGCTCATCACTTCCAGCATATTCCTCTGCAGAGTGTGTAGGAAGGGCCCCACGCTCAGCTTCAGAGTCTTCCTGTTATTGGGTCCTATGACATAAGAGATGACATCAATAGCTCTCTCTTCTATTCTCTGCAGGTTTGACTTGTCCTTTAGTGGGCAGGGAAATCCGTGGACCTCTTGAGCCAACAGGTTGTCGAGGAGAAGAAAGAAATCCAATTCCTTTGTAGAGTCAATGTTCATCTCCTGCCGCAGCTTCTCCAGATCCTCTGACATCCCAAGGCTGGGAGGAGGCACTGGACGTCATGTTACTGGTCAGCTGTTTTACCTTTTGGCACCCATGGTAATTTGGGATCAAAATCTCAACCGTTGGCCTTCCGCCGTTTCGAATGGTCACTGGTTCCTTTCTTGCTTGTTGTAAGAAAAAGTCCCACCCAGGCAAAACAAACGG
Full Trace Sequence: GAAAAGGCTATTGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATCTTCTCTGTGTCTGTAATGGAACACTGCGCCTTGTAATCTTCTGGGCTTAACGCAAACTCGGATAACGCCCCGAGGAATTCTCTTAATGGGCAGAGACCCGACTGGCATCCTCTCACCTCCTGCTCCTCTCCGTTGTATCGGAGGCTCACAAACCAGTCCTTGGAGCGCCGGTGCTGGTAAAGTTCTAACGTCAGATCGGAGGCGTAGGGAGGCCACTTCTTGTTAAAGATCCCAAGAGCCATCAGGAGGGGTATCAGGGTGACATCATGGGCAGCATAGAGATAGAACTTCCTGGCCTGTGTCTCTGCACCTGCTCTGCTCATCACTTCCAGCATATTCCTCTGCAGAGTGTGTAGGAAGGGCCCCACGCTCAGCTTCAGAGTCTTCCTGTTATTGGGTCCTATGACATAAGAGATGACATCAATAGCTCTCTCTTCTATTCTCTGCAGGTTTGACTTGTCCTTTAGTGGGCAGGGAAATCCGTGGACCTCTTGAGCCAACAGGTTGTCGAGGAGAAGAAAGAAATCCAATTCCTTTGTAGAGTCAATGTTCATCTCCTGCCGCAGCTTCTCCAGATCCTCTGACATCCCAAGGCTGGGAGGAGGCACTGGACGTCATGTTACTGGTCAGCTGTTTTACCTTTTGGCACCCATGGTAATTTGGGATCAAAATCTCAACCGTTGGCCTTCCGCCGTTTCGAATGGTCACTGGTTCCTTTCTTGCTTGTTGTAAGAAAAAGTCCCACCCAGGCAAAACAAACGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCTTCTCTGTGTCTGTAATGG