ORFeome > acsbg2 ORF1 – XORFeome v1.0

acsbg2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: acsbg2
Gene ID: 1006643
Gene Page ID: 1006639
ORF Xenbase ID: 17262975

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043850
Original XGC clone length: 2220

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ823851
dbEST ID: 79641553
Trimmed Sequence: ATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTNNTAAGCATCATCCAGTACAAGGACGAGCTGAAGGAGAAGAGGCCTTAATCTGTATACCGTGGAAAGAATTTAATGCCAACTTGGGAAAAAAAAATTTCCCAAACTTCTTCAAATTT
Full Trace Sequence: AATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTNNTAAGCATCATCCAGTACAAGGACGAGCTGAAGGAGAAGAGGCCTTAATCTGTATACCGTGGAAAGAATTTAATGCCAACTTGGGAAAAAAAAATTTCCCAAACTTCTTCAAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGTGATTTCAAATTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829159
dbEST ID: 79646861
Trimmed Sequence: CTTAGGAGGGGTGAAGTTTTCCGTAGGGGTTCCTGCATCCTGATAGAAGCTATCAATTTGGTCTTTGTACATCTTTGCCACTACTGGACGTTTTAACTTCATGGTGGGGCCCAATTCTCCTCCAGTGATAGAAAAATCTTTTTCAAGAATGAGCCACTTTTGGACCTTCTGAGCATTTGAGGTTGACTTCTCATTTACTGAATTTACCCCTTCCTGGATTGCAGCATATACAGCTGTGTCTTTGCCCCCAACTATGTCAGATACCAGTGTGGCTTTGCTGCCGATCTGCCGACAAAACTGAATGGCTTCAGGCGTGAGTTCATCCTCTGGCTCCCCCGTGTCTGCATTCACATTGCACTTAAGAGTTAGAAGCATGGAAAGGAACTTCTTCTTGTCTCCAATCAACATGGCATTACTGATTATTGGAACTTGCTCTTTTACAGCATCTTCAGTTGGAACAGGAGGGATGTTCTCTCCACCTGCCGTTATTATCAGCTCTTTGATTCTTCCAGTAATATAAAGAAATCCATTCTCATCGTGTTTCCCAATATCACCAGAATGCAACCAGCCTTCCTCATCCAAGGACTCGTGTGTTTTGTCTTCCATGTTNCAATATCCCATAAAGACATGACGTCCCCAGAAAAGGATCTCCCCACTGCCATCACTGTCTGGCTGATGGATCTTTGTCTTGCACCNTGGAAATAACTTTTCCCCCAACTGGGTGATTTCTGAAAAACATCAGGGCCAAAGAAAAAGG
Full Trace Sequence: CGGCAGTGTATCAGCTATGACCATGTAATACGACTCACTATANGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTAGGAGGGGTGAAGTTTTCCGTAGGGGTTCCTGCATCCTGATAGAAGCTATCAATTTGGTCTTTGTACATCTTTGCCACTACTGGACGTTTTAACTTCATGGTGGGGCCCAATTCTCCTCCAGTGATAGAAAAATCTTTTTCAAGAATGAGCCACTTTTGGACCTTCTGAGCATTTGAGGTTGACTTCTCATTTACTGAATTTACCCCTTCCTGGATTGCAGCATATACAGCTGTGTCTTTGCCCCCAACTATGTCAGATACCAGTGTGGCTTTGCTGCCGATCTGCCGACAAAACTGAATGGCTTCAGGCGTGAGTTCATCCTCTGGCTCCCCCGTGTCTGCATTCACATTGCACTTAAGAGTTAGAAGCATGGAAAGGAACTTCTTCTTGTCTCCAATCAACATGGCATTACTGATTATTGGAACTTGCTCTTTTACAGCATCTTCAGTTGGAACAGGAGGGATGTTCTCTCCACCTGCCGTTATTATCAGCTCTTTGATTCTTCCAGTAATATAAAGAAATCCATTCTCATCGTGTTTCCCAATATCACCAGAATGCAACCAGCCTTCCTCATCCAAGGACTCGTGTGTTTTGTCTTCCATGTTNCAATATCCCATAAAGACATGACGTCCCCAGAAAAGGATCTCCCCACTGCCATCACTGTCTGGCTGATGGATCTTTGTCTTGCACCNTGGAAATAACTTTTCCCCCAACTGGGTGATTTCTGAAAAACATCAGGGCCAAAGAAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTAGGAGGGGTGAAGTTTTCCGT