ORFeome > acta2 ORF2 – XORFeome v1.0

acta2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: acta2
Gene ID: 866302
Gene Page ID: 493936
ORF Xenbase ID: 17263023

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082830
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID: 59
Ensembl gene IDs: ENSG00000107796
Directly associated (OMIM) disease MIM numbers: 611788,613834,614042
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,115200,123500,131950,135300,193100,211900,215600,226670,607907,609307

Library Location

Plate ID: GDExl11031
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ826219
dbEST ID: 79643921
Trimmed Sequence: ATGTGTGACGAAGAAGACACTACTGCACTGGTGTGTGACAATGGCTCTGGACTCTGCAAGGCTGGATTTGCTGGGGACGATGCTCCAAGGGCCGTATTCCCCTCCATCGTGGGTCGCCCCAGGCACCAGGGTGTGATGGTTGGTATGGGTCAGAAGGACAGCTATGTTGGTGATGAAGCTCAGAGCAAGAGAGGTATTCTGACACTGAAATACCCAATTGAACACGGCATCATTACAAACTGGGATGACATGGAGAAGATCTGGCACCACAGCTTCTACAATGAATTACGAGTGGCCCCAGAGGAACACCCAACCCTGCTCACTGAGGCTCCACTGAATCCCAAAGCTAACAGAGAAAAAATGACCCAGATAATGTTTGAGACATTTAACGTGCCAGCAATGTACGTTGCTATTCAGGCGGTGCTATCCCTCTATGCTTCTGGCCGTACTACTGGTATCGTACTTGACTCTGGTGATGGTGTCACCCACAATGTACCAATCTATGAAGGGTATGCTCTTCCTCATGCAATCATGCGTCTTGACCTGGCTGGCCGTGACCTAACAGACTACCTCATGAAGATCTTGACTGAACGCGGCTATTCCTTTGTAACTACTGCTGAGCGTGAAATTGTGCGAGACATCAAGGAGAAACTGTGCTATGTAGCCCCTTGACTTTAAAAAAGAAATGGCTACCGCTTCCTCCTTCCTCTTCCTCTGAAAAAAAATTATGAACTTTCCCCAACGGTCCAGGTTATCCCCAATTTGGAAAATTGAAACG
Full Trace Sequence: GGGTCTATGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGAAGAAGACACTACTGCACTGGTGTGTGACAATGGCTCTGGACTCTGCAAGGCTGGATTTGCTGGGGACGATGCTCCAAGGGCCGTATTCCCCTCCATCGTGGGTCGCCCCAGGCACCAGGGTGTGATGGTTGGTATGGGTCAGAAGGACAGCTATGTTGGTGATGAAGCTCAGAGCAAGAGAGGTATTCTGACACTGAAATACCCAATTGAACACGGCATCATTACAAACTGGGATGACATGGAGAAGATCTGGCACCACAGCTTCTACAATGAATTACGAGTGGCCCCAGAGGAACACCCAACCCTGCTCACTGAGGCTCCACTGAATCCCAAAGCTAACAGAGAAAAAATGACCCAGATAATGTTTGAGACATTTAACGTGCCAGCAATGTACGTTGCTATTCAGGCGGTGCTATCCCTCTATGCTTCTGGCCGTACTACTGGTATCGTACTTGACTCTGGTGATGGTGTCACCCACAATGTACCAATCTATGAAGGGTATGCTCTTCCTCATGCAATCATGCGTCTTGACCTGGCTGGCCGTGACCTAACAGACTACCTCATGAAGATCTTGACTGAACGCGGCTATTCCTTTGTAACTACTGCTGAGCGTGAAATTGTGCGAGACATCAAGGAGAAACTGTGCTATGTAGCCCCTTGACTTTAAAAAAGAAATGGCTACCGCTTCCTCCTTCCTCTTCCTCTGAAAAAAAATTATGAACTTTCCCCAACGGTCCAGGTTATCCCCAATTTGGAAAATTGAAACG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGAAGAAGACACTA

Sequences - 3ʹ (reverse) EST

Accession: JZ826218
dbEST ID: 79643920
Trimmed Sequence: GAAGCATTTGCGGTGAACAATGGAGGGGCCGGCTTCGTCGTATTCGGGTTTGCTGATCCACATCTGCTGGAAGGTAGACAGGGAGGCGAGGATGGAGCCACCAATCCAGACGGAGTACTTACGCTCAGGTGGGGCAATGATCTTGATTTTCATTGTGCTGGGGGCCAAAGCAGTGATCTCCTTCTGCATTCTGTCAGCAATGCCAGGGTACATGGTGGTACCACCGGACAGTACGTTGTTGGCATACAGGTCCTTTCGGATGTCTATGTCGCATTTCATGATGCTGTTGTAAGTGGTTTCATGGATACCGGCAGATTCCATACCAATGAAAGATGGCTGGAACAGGGTCTCGGGGCAGCGGAAACGCTCATTTCCAATTGTGATGACCTGACCGTCGGGAAGTTCATAACTCTTTTCCAGAGAGGAGGAGGAGGCAGCGGTAGCCATTTCATTCTCAAAGTCAAGGGCTACGTAGCACAGCTTCTCCTTGATGTCTCGCACAATTTCACGCTCAGCAGTAATTACAAAGGAATAACCGCGTTCAGTCAAGATCTTCATGAAGTAATCGGTTAAGGTCCCGGCCGGGCGGGGTCAGGACGCAGGAAGTGATGAGGGGGAGGGAACCCCTTCCTAGATTGGTAACGTTGGTGGGGGACACCGGCAGCAAAACCTAGGTCCCAAACCCAGATAATGAGCGCAAAAAACCGTAAAGAGGAAAACCACCGCCCGGAGAAAAGAACCGGGACCGTTCTTGCGGCTCCGTTTAAAAGT
Full Trace Sequence: GTGCAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGCATTTGCGGTGAACAATGGAGGGGCCGGCTTCGTCGTATTCGGGTTTGCTGATCCACATCTGCTGGAAGGTAGACAGGGAGGCGAGGATGGAGCCACCAATCCAGACGGAGTACTTACGCTCAGGTGGGGCAATGATCTTGATTTTCATTGTGCTGGGGGCCAAAGCAGTGATCTCCTTCTGCATTCTGTCAGCAATGCCAGGGTACATGGTGGTACCACCGGACAGTACGTTGTTGGCATACAGGTCCTTTCGGATGTCTATGTCGCATTTCATGATGCTGTTGTAAGTGGTTTCATGGATACCGGCAGATTCCATACCAATGAAAGATGGCTGGAACAGGGTCTCGGGGCAGCGGAAACGCTCATTTCCAATTGTGATGACCTGACCGTCGGGAAGTTCATAACTCTTTTCCAGAGAGGAGGAGGAGGCAGCGGTAGCCATTTCATTCTCAAAGTCAAGGGCTACGTAGCACAGCTTCTCCTTGATGTCTCGCACAATTTCACGCTCAGCAGTAATTACAAAGGAATAACCGCGTTCAGTCAAGATCTTCATGAAGTAATCGGTTAAGGTCCCGGCCGGGCGGGGTCAGGACGCAGGAAGTGATGAGGGGGAGGGAACCCCTTCCTAGATTGGTAACGTTGGTGGGGGACACCGGCAGCAAAACCTAGGTCCCAAACCCAGATAATGAGCGCAAAAAACCGTAAAGAGGAAAACCACCGCCCGGAGAAAAGAACCGGGACCGTTCTTGCGGCTCCGTTTAAAAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCATTTGCGGTGAACAATGGA