ORFeome > actb ORF1 – XORFeome v1.0

actb ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: actb
Gene ID: 866011
Gene Page ID: 490882
ORF Xenbase ID: 17263029

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084121
Original XGC clone length: 1128

Human orthology & disease relationships

NCBI Entrez ID: 60
Ensembl gene IDs: ENSG00000075624,ENSG00000184009,LRG_132
Directly associated (OMIM) disease MIM numbers: 243310,607371
Indirectly associated (Lage, et al.) disease MIM numbers: 105120,114480,114500,118400,121850,124900,125800,125853,148700,151623,153640,153650,154500,155100,161800,162210,173100,173900,182290,193520,209300,209950,211980,214450,215600,219050,253300,253400,253550,256710,261100,262400,262650,266600,274500,300049,300436,300537,300558,301000,303600,304120,305620,309350,311300,313900,600334,600652,600802,601665,601675,602579,603278,603622,603689,604145,604370,604416,605249,606003,607136,607748,607785,607841,608203,608594,608751,608807,608808,609135,609227,609285,609322

Library Location

Plate ID: GDExl11005
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ840024
dbEST ID: 79657726
Trimmed Sequence: ATGGAAACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAAATGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCAAAAGAGAAATCGTTCGTGATATCAAAGAAAAATTGTGCTATGTTGCTCTGGACTTTTAGCAGGAAATGGCCACACCTGCCTCCTTCTTCTCATTTGAAAAAAAACTTTGAACTGCCCTGAAGGAAAAATCATCACCATTGGTTAA
Full Trace Sequence: GCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGGTTGGCACCATGGAAACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAAATGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCAAAAGAGAAATCGTTCGTGATATCAAAGAAAAATTGTGCTATGTTGCTCTGGACTTTTAGCAGGAAATGGCCACACCTGCCTCCTTCTTCTCATTTGAAAAAAAACTTTGAACTGCCCTGAAGGAAAAATCATCACCATTGGTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGACGATATTGCCGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ840023
dbEST ID: 79657725
Trimmed Sequence: GAAGCATTTACGGTGGACAATTGAGGGGCCAGACTCATCATACTCCTGCTTGCTGATCCACATCTGCTGGAAGGTGGACAGGGAAGCCAAGATGGAGCCACCAATCCAGACAGAGTATTTACGCTCAGGGGGGGCAATTATCTTGATTTTCATGGTGCTGGGGGCTAGTGCAGTTATTTCTTTCTGCATTCTATCAGCAATTCCTGGGTACATTGTGGTACCACCAGACAGAACAGTATTGGCATAGAGGTCCTTACGGATATCTACATCACACTTCATAATTGAGTTGTAAGTGGTTTCATGAATACCGCAGGATTCCATACCAAGGAAAGATGGCTGGAAGAGGGCCTCTGGACATCTAAAACGCTCGTTACCAATGGTGATGACTTGTCCGTCAGGCAGCTCATAGCTCTTTTCCAATGATGAAGAAGAGGCAGCTGTGGCCATCTCCTGCTCAAAGTCCAGAGCAACATAGCACAATTTCTCCTTGATATCGGGAACGATTTCTCTTTCGGCCTGGGGTGGTGAAGCTGTACCCCCTCTCAGTTAAGATTTTCATGAAGTAGTCTGTCAGGGCACGTCCAGCCCAGTCCAGACGCAGAATGGCATGGGGGTGAGCATAGCCTTCATATATGGCCACATTGTGGTTTACCCGATCACTTAATTCCATGGACAATACCAGTGGTACAACCAGAATGCATACA
Full Trace Sequence: GAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGGATGGCAAAAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGCATTTACGGTGGACAATTGAGGGGCCAGACTCATCATACTCCTGCTTGCTGATCCACATCTGCTGGAAGGTGGACAGGGAAGCCAAGATGGAGCCACCAATCCAGACAGAGTATTTACGCTCAGGGGGGGCAATTATCTTGATTTTCATGGTGCTGGGGGCTAGTGCAGTTATTTCTTTCTGCATTCTATCAGCAATTCCTGGGTACATTGTGGTACCACCAGACAGAACAGTATTGGCATAGAGGTCCTTACGGATATCTACATCACACTTCATAATTGAGTTGTAAGTGGTTTCATGAATACCGCAGGATTCCATACCAAGGAAAGATGGCTGGAAGAGGGCCTCTGGACATCTAAAACGCTCGTTACCAATGGTGATGACTTGTCCGTCAGGCAGCTCATAGCTCTTTTCCAATGATGAAGAAGAGGCAGCTGTGGCCATCTCCTGCTCAAAGTCCAGAGCAACATAGCACAATTTCTCCTTGATATCGGGAACGATTTCTCTTTCGGCCTGGGGTGGTGAAGCTGTACCCCCTCTCAGTTAAGATTTTCATGAAGTAGTCTGTCAGGGCACGTCCAGCCCAGTCCAGACGCAGAATGGCATGGGGGTGAGCATAGCCTTCATATATGGCCACATTGTGGTTTACCCGATCACTTAATTCCATGGACAATACCAGTGGTACAACCAGAATGCATACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCATTTACGGTGGACAA